Incidental Mutation 'R4164:Kank1'
ID321680
Institutional Source Beutler Lab
Gene Symbol Kank1
Ensembl Gene ENSMUSG00000032702
Gene NameKN motif and ankyrin repeat domains 1
SynonymsD330024H06Rik, Ankrd15, A930031B09Rik
MMRRC Submission 041638-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4164 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location25236975-25434496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25411072 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 703 (D703G)
Ref Sequence ENSEMBL: ENSMUSP00000116660 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049400] [ENSMUST00000146647]
Predicted Effect probably benign
Transcript: ENSMUST00000049400
AA Change: D675G

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000042177
Gene: ENSMUSG00000032702
AA Change: D675G

DomainStartEndE-ValueType
Pfam:KN_motif 30 68 3.3e-24 PFAM
low complexity region 88 105 N/A INTRINSIC
low complexity region 138 148 N/A INTRINSIC
coiled coil region 286 314 N/A INTRINSIC
low complexity region 350 358 N/A INTRINSIC
coiled coil region 362 395 N/A INTRINSIC
coiled coil region 451 494 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
low complexity region 617 629 N/A INTRINSIC
Blast:ANK 963 993 7e-10 BLAST
low complexity region 1010 1030 N/A INTRINSIC
low complexity region 1074 1095 N/A INTRINSIC
ANK 1169 1199 3.71e-4 SMART
ANK 1203 1236 2.27e1 SMART
ANK 1241 1270 1.33e-5 SMART
ANK 1274 1306 5.84e-2 SMART
ANK 1308 1336 4.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137260
Predicted Effect probably benign
Transcript: ENSMUST00000146647
AA Change: D703G

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116660
Gene: ENSMUSG00000032702
AA Change: D703G

DomainStartEndE-ValueType
Pfam:KN_motif 58 96 2e-25 PFAM
low complexity region 116 133 N/A INTRINSIC
low complexity region 166 176 N/A INTRINSIC
coiled coil region 314 342 N/A INTRINSIC
low complexity region 378 386 N/A INTRINSIC
coiled coil region 390 423 N/A INTRINSIC
internal_repeat_1 430 479 3.72e-5 PROSPERO
low complexity region 569 584 N/A INTRINSIC
internal_repeat_1 587 636 3.72e-5 PROSPERO
low complexity region 645 657 N/A INTRINSIC
Blast:ANK 991 1021 4e-10 BLAST
low complexity region 1038 1058 N/A INTRINSIC
low complexity region 1102 1123 N/A INTRINSIC
Meta Mutation Damage Score 0.0806 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 89% (40/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Kank family of proteins, which contain multiple ankyrin repeat domains. This family member functions in cytoskeleton formation by regulating actin polymerization. This gene is a candidate tumor suppressor for renal cell carcinoma. Mutations in this gene cause cerebral palsy spastic quadriplegic type 2, a central nervous system development disorder. A t(5;9) translocation results in fusion of the platelet-derived growth factor receptor beta gene (PDGFRB) on chromosome 5 with this gene in a myeloproliferative neoplasm featuring severe thrombocythemia. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap1 C T 11: 69,890,037 A164T probably benign Het
Ash1l A G 3: 88,981,966 D384G probably damaging Het
Cntn5 A G 9: 9,781,676 V666A probably damaging Het
Defb41 C T 1: 18,260,597 C42Y probably damaging Het
Dennd4c C A 4: 86,807,527 N739K probably benign Het
Dnah6 C T 6: 73,089,592 W2598* probably null Het
Ell G T 8: 70,581,573 R30L probably damaging Het
Fam189a2 G A 19: 23,975,629 A439V probably damaging Het
Fam189a2 C T 19: 23,975,638 S436N probably damaging Het
Fer1l6 A C 15: 58,559,238 R247S possibly damaging Het
Flnb A T 14: 7,915,374 I1502F possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm2223 C T X: 33,505,784 noncoding transcript Het
Ifi203 A T 1: 173,928,463 probably benign Het
Ighm T A 12: 113,422,295 E108V unknown Het
Il23r T A 6: 67,423,663 Q561L probably benign Het
Kcnt2 A T 1: 140,609,630 Y1109F probably damaging Het
Lamb2 T A 9: 108,490,298 Y1760N probably damaging Het
Lrpprc T C 17: 84,731,189 E950G possibly damaging Het
Lrrc66 T A 5: 73,629,776 probably null Het
Mtbp T C 15: 55,609,521 V627A probably benign Het
Myo10 T A 15: 25,726,415 probably null Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Nipbl T C 15: 8,338,934 N1142S probably benign Het
Nrxn2 G A 19: 6,532,143 V660I probably damaging Het
Oas1c T C 5: 120,808,139 E98G probably damaging Het
Olfr160 T G 9: 37,711,698 I194L probably benign Het
Otx1 A G 11: 21,996,638 probably benign Het
Prkcd A G 14: 30,601,197 F461L probably damaging Het
Prune2 T C 19: 17,003,734 F85S possibly damaging Het
Rnf214 G A 9: 45,871,912 R184W probably damaging Het
Scn5a T C 9: 119,495,778 N1328S probably damaging Het
Secisbp2l T C 2: 125,751,883 probably benign Het
Smarcal1 A G 1: 72,626,689 probably benign Het
Snx21 T C 2: 164,786,850 Y138H probably damaging Het
Sox5 T A 6: 144,116,480 R149W probably damaging Het
Spout1 C T 2: 30,177,577 probably benign Het
Tlr1 A G 5: 64,927,202 C11R possibly damaging Het
Vmn2r23 A T 6: 123,729,738 H509L probably benign Het
Other mutations in Kank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00324:Kank1 APN 19 25411758 missense probably benign
IGL00435:Kank1 APN 19 25430236 missense probably benign 0.41
IGL01105:Kank1 APN 19 25424316 missense possibly damaging 0.80
IGL01974:Kank1 APN 19 25410232 missense possibly damaging 0.87
IGL02031:Kank1 APN 19 25410702 missense probably benign 0.01
IGL02125:Kank1 APN 19 25410703 missense possibly damaging 0.90
IGL02152:Kank1 APN 19 25428172 missense possibly damaging 0.51
IGL02211:Kank1 APN 19 25430338 missense probably damaging 1.00
IGL02440:Kank1 APN 19 25432908 missense probably damaging 1.00
IGL02448:Kank1 APN 19 25411375 missense probably damaging 1.00
IGL02671:Kank1 APN 19 25428095 missense probably damaging 1.00
IGL03102:Kank1 APN 19 25425918 missense probably damaging 1.00
IGL03259:Kank1 APN 19 25430341 missense probably damaging 1.00
IGL02802:Kank1 UTSW 19 25411599 missense probably damaging 1.00
R0107:Kank1 UTSW 19 25430366 unclassified probably benign
R0190:Kank1 UTSW 19 25409283 missense probably benign 0.00
R0330:Kank1 UTSW 19 25424313 missense probably benign 0.00
R0368:Kank1 UTSW 19 25410603 nonsense probably null
R0399:Kank1 UTSW 19 25411242 missense probably benign 0.00
R0426:Kank1 UTSW 19 25411473 missense probably damaging 1.00
R0483:Kank1 UTSW 19 25425993 unclassified probably benign
R1394:Kank1 UTSW 19 25428164 missense probably damaging 1.00
R1495:Kank1 UTSW 19 25410349 missense probably damaging 0.98
R1681:Kank1 UTSW 19 25410304 missense possibly damaging 0.89
R1698:Kank1 UTSW 19 25411317 missense probably benign 0.11
R1830:Kank1 UTSW 19 25411032 missense probably benign 0.00
R1866:Kank1 UTSW 19 25411449 missense probably benign 0.04
R2138:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2139:Kank1 UTSW 19 25411753 missense probably benign 0.00
R2420:Kank1 UTSW 19 25410457 missense probably damaging 1.00
R3153:Kank1 UTSW 19 25410688 missense possibly damaging 0.89
R4670:Kank1 UTSW 19 25410580 missense probably benign 0.00
R4685:Kank1 UTSW 19 25410034 missense possibly damaging 0.66
R4843:Kank1 UTSW 19 25431007 missense probably damaging 1.00
R4981:Kank1 UTSW 19 25411395 missense probably benign 0.19
R5189:Kank1 UTSW 19 25424181 missense probably damaging 1.00
R5280:Kank1 UTSW 19 25411305 missense probably benign 0.01
R5330:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5331:Kank1 UTSW 19 25411329 missense probably damaging 1.00
R5435:Kank1 UTSW 19 25411143 missense probably benign 0.04
R5500:Kank1 UTSW 19 25424332 missense possibly damaging 0.46
R5894:Kank1 UTSW 19 25424200 missense probably damaging 1.00
R6087:Kank1 UTSW 19 25409724 missense probably benign 0.41
R6357:Kank1 UTSW 19 25411353 missense probably benign 0.36
R6490:Kank1 UTSW 19 25410085 missense probably damaging 1.00
R6504:Kank1 UTSW 19 25428154 missense probably damaging 1.00
R6942:Kank1 UTSW 19 25424173 missense possibly damaging 0.88
R7037:Kank1 UTSW 19 25430341 missense probably damaging 1.00
R7405:Kank1 UTSW 19 25410319 nonsense probably null
R7486:Kank1 UTSW 19 25410829 missense probably damaging 0.99
R7602:Kank1 UTSW 19 25422161 missense probably benign 0.01
R7701:Kank1 UTSW 19 25411765 critical splice donor site probably null
R7765:Kank1 UTSW 19 25411205 frame shift probably null
R7766:Kank1 UTSW 19 25411205 frame shift probably null
R7768:Kank1 UTSW 19 25411205 frame shift probably null
R8020:Kank1 UTSW 19 25411205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCGACCTGACACTCCTTAAGAC -3'
(R):5'- CAGAATTGCCAGACAGCACTG -3'

Sequencing Primer
(F):5'- CTGACACTCCTTAAGACAAACTTG -3'
(R):5'- ACCAACGGACCGAGTCTTAGTG -3'
Posted On2015-06-12