Incidental Mutation 'R4165:Rps3'
ID 321691
Institutional Source Beutler Lab
Gene Symbol Rps3
Ensembl Gene ENSMUSG00000030744
Gene Name ribosomal protein S3
Synonyms D7Ertd795e
MMRRC Submission 041007-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.963) question?
Stock # R4165 (G1)
Quality Score 182
Status Validated
Chromosome 7
Chromosomal Location 99127103-99132916 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 99132816 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 5 (I5V)
Ref Sequence ENSEMBL: ENSMUSP00000102713 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032998] [ENSMUST00000107096] [ENSMUST00000208532]
AlphaFold P62908
Predicted Effect probably benign
Transcript: ENSMUST00000032998
AA Change: I5V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032998
Gene: ENSMUSG00000030744
AA Change: I5V

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083888
Predicted Effect probably benign
Transcript: ENSMUST00000107096
AA Change: I5V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000102713
Gene: ENSMUSG00000030744
AA Change: I5V

DomainStartEndE-ValueType
KH 42 111 2.83e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128725
Predicted Effect probably benign
Transcript: ENSMUST00000208532
AA Change: I5V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1454 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aak1 T A 6: 86,827,044 (GRCm39) F4I probably damaging Het
Adamts8 G T 9: 30,862,684 (GRCm39) E296D probably benign Het
Alg11 T C 8: 22,555,573 (GRCm39) V278A probably damaging Het
Ankfy1 G A 11: 72,605,310 (GRCm39) probably null Het
Avil C T 10: 126,842,496 (GRCm39) Q92* probably null Het
Cfap300 A T 9: 8,026,071 (GRCm39) L167Q probably damaging Het
CK137956 A T 4: 127,864,522 (GRCm39) S36T possibly damaging Het
Epb41l3 T C 17: 69,514,883 (GRCm39) S7P probably damaging Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Fsd2 T C 7: 81,195,608 (GRCm39) T434A probably damaging Het
Gm5174 A G 10: 86,492,797 (GRCm39) noncoding transcript Het
Gpaa1 A C 15: 76,216,667 (GRCm39) probably benign Het
Grina T A 15: 76,133,529 (GRCm39) L334Q probably damaging Het
Gvin-ps5 T A 7: 105,929,895 (GRCm39) noncoding transcript Het
Igkv15-103 G T 6: 68,414,824 (GRCm39) G88* probably null Het
Ip6k2 G A 9: 108,682,847 (GRCm39) R319Q probably benign Het
Kdm3b A T 18: 34,928,797 (GRCm39) I183F probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Larp7 A G 3: 127,330,611 (GRCm39) Y569H probably benign Het
Loxhd1 A T 18: 77,460,025 (GRCm39) I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 (GRCm38) I189V probably benign Het
Odad2 A T 18: 7,217,008 (GRCm39) I668K probably damaging Het
Pcdhb19 T A 18: 37,632,243 (GRCm39) N679K probably benign Het
Pigr G A 1: 130,769,554 (GRCm39) D122N probably benign Het
Prap1 T A 7: 139,676,091 (GRCm39) V35E probably benign Het
Prdm1 T A 10: 44,317,572 (GRCm39) Y417F probably benign Het
Ralgapa1 C T 12: 55,687,429 (GRCm39) R2019Q probably damaging Het
Sema3a A T 5: 13,523,364 (GRCm39) probably null Het
Serpina3g A T 12: 104,206,546 (GRCm39) T116S probably benign Het
Skint11 C A 4: 114,101,856 (GRCm39) Q99K probably benign Het
Slc22a28 A G 19: 8,040,773 (GRCm39) S493P possibly damaging Het
Snapc1 G T 12: 74,029,354 (GRCm39) probably null Het
Sobp C T 10: 42,897,644 (GRCm39) G647D probably damaging Het
Tomm22 C A 15: 79,555,206 (GRCm39) probably benign Het
Trappc11 T C 8: 47,978,003 (GRCm39) probably benign Het
Txnl4a T A 18: 80,265,471 (GRCm39) M112K probably benign Het
Vmn2r16 T C 5: 109,478,427 (GRCm39) F61L possibly damaging Het
Zfp709 C T 8: 72,644,649 (GRCm39) Q693* probably null Het
Other mutations in Rps3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02282:Rps3 APN 7 99,128,479 (GRCm39) critical splice donor site probably null
R3710:Rps3 UTSW 7 99,128,626 (GRCm39) missense probably benign 0.02
R3894:Rps3 UTSW 7 99,129,103 (GRCm39) missense probably benign 0.07
R3895:Rps3 UTSW 7 99,129,103 (GRCm39) missense probably benign 0.07
R8318:Rps3 UTSW 7 99,132,938 (GRCm39) unclassified probably benign
R8797:Rps3 UTSW 7 99,132,797 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCGAGTCGGTCCAGAACTC -3'
(R):5'- AGGTTGCTAGGTTACACCCC -3'

Sequencing Primer
(F):5'- TCGGTCCAGAACTCGAGGAG -3'
(R):5'- CCCCTACGCCGTTTTAGAC -3'
Posted On 2015-06-12