Incidental Mutation 'R4165:Adamts8'
ID321698
Institutional Source Beutler Lab
Gene Symbol Adamts8
Ensembl Gene ENSMUSG00000031994
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 8
SynonymsMETH-2, METH2
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location30942562-30963838 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 30951388 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 296 (E296D)
Ref Sequence ENSEMBL: ENSMUSP00000069644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068135] [ENSMUST00000163037]
Predicted Effect probably benign
Transcript: ENSMUST00000068135
AA Change: E296D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000069644
Gene: ENSMUSG00000031994
AA Change: E296D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Pep_M12B_propep 35 152 6.4e-23 PFAM
Pfam:Reprolysin_5 232 418 1.3e-15 PFAM
Pfam:Reprolysin_4 233 435 3.4e-8 PFAM
Pfam:Reprolysin 234 444 3.8e-21 PFAM
Pfam:Reprolysin_2 252 434 1.3e-10 PFAM
Pfam:Reprolysin_3 255 389 7.4e-14 PFAM
TSP1 545 597 7.04e-14 SMART
Pfam:ADAM_spacer1 706 825 3.2e-35 PFAM
TSP1 851 904 5.35e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163037
AA Change: E89D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124848
Gene: ENSMUSG00000031994
AA Change: E89D

DomainStartEndE-ValueType
PDB:2V4B|B 22 128 2e-38 PDB
SCOP:d1kufa_ 27 128 2e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214688
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is expressed in mouse lung, heart and macrophage-rich areas of atherosclerotic plaques. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent aggrecanase enzyme. This gene is located adjacent to a related ADAMTS gene on chromosome 9. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Adamts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Adamts8 APN 9 30953500 missense probably damaging 1.00
IGL02049:Adamts8 APN 9 30951354 missense probably damaging 0.96
IGL02304:Adamts8 APN 9 30956656 missense possibly damaging 0.55
IGL02385:Adamts8 APN 9 30961730 missense probably benign 0.10
IGL02536:Adamts8 APN 9 30962072 missense probably benign 0.05
IGL03347:Adamts8 APN 9 30959238 missense possibly damaging 0.75
R0633:Adamts8 UTSW 9 30943511 missense probably damaging 1.00
R1066:Adamts8 UTSW 9 30956541 missense probably damaging 1.00
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1464:Adamts8 UTSW 9 30951377 missense probably benign
R1560:Adamts8 UTSW 9 30956667 missense probably damaging 1.00
R1592:Adamts8 UTSW 9 30943176 missense probably damaging 0.99
R1753:Adamts8 UTSW 9 30954614 missense probably benign 0.04
R1932:Adamts8 UTSW 9 30956512 missense probably benign
R2087:Adamts8 UTSW 9 30962112 missense probably damaging 1.00
R2118:Adamts8 UTSW 9 30943063 missense probably damaging 1.00
R3789:Adamts8 UTSW 9 30959292 missense probably damaging 1.00
R4166:Adamts8 UTSW 9 30951388 missense probably benign 0.01
R4193:Adamts8 UTSW 9 30959308 missense probably damaging 1.00
R4425:Adamts8 UTSW 9 30956656 missense possibly damaging 0.55
R5155:Adamts8 UTSW 9 30954548 missense probably benign 0.33
R5433:Adamts8 UTSW 9 30961716 missense probably benign 0.01
R5544:Adamts8 UTSW 9 30952703 missense probably damaging 1.00
R5590:Adamts8 UTSW 9 30951336 missense probably damaging 0.97
R5640:Adamts8 UTSW 9 30956500 missense probably benign 0.00
R5800:Adamts8 UTSW 9 30954482 missense probably damaging 1.00
R5909:Adamts8 UTSW 9 30961928 missense probably benign 0.00
R6821:Adamts8 UTSW 9 30956626 missense probably benign 0.08
R6967:Adamts8 UTSW 9 30954491 missense probably benign 0.04
R7336:Adamts8 UTSW 9 30962067 missense probably benign 0.00
R7538:Adamts8 UTSW 9 30953470 missense probably damaging 1.00
R7540:Adamts8 UTSW 9 30959064 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CGTCTCCTAATGAGGTGGTAG -3'
(R):5'- TGTTTGGGCAGGCTCCAAAG -3'

Sequencing Primer
(F):5'- TGGTAGGAGTGGGCAGCC -3'
(R):5'- AAAGCCCTCCCTTTGATCTG -3'
Posted On2015-06-12