Incidental Mutation 'R4165:Ip6k2'
ID321699
Institutional Source Beutler Lab
Gene Symbol Ip6k2
Ensembl Gene ENSMUSG00000032599
Gene Nameinositol hexaphosphate kinase 2
SynonymsIhpk2, 1500005N04Rik
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location108783796-108806337 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108805648 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 319 (R319Q)
Ref Sequence ENSEMBL: ENSMUSP00000082091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035218] [ENSMUST00000085018] [ENSMUST00000193560] [ENSMUST00000194819] [ENSMUST00000195323]
Predicted Effect probably benign
Transcript: ENSMUST00000035218
SMART Domains Protein: ENSMUSP00000035218
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 2.21e-9 SMART
low complexity region 162 179 N/A INTRINSIC
low complexity region 200 215 N/A INTRINSIC
low complexity region 230 240 N/A INTRINSIC
low complexity region 249 271 N/A INTRINSIC
low complexity region 288 298 N/A INTRINSIC
Pfam:DUF2013 539 675 5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000085018
AA Change: R319Q

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082091
Gene: ENSMUSG00000032599
AA Change: R319Q

DomainStartEndE-ValueType
Pfam:IPK 225 440 2.7e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193560
AA Change: R273Q

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141605
Gene: ENSMUSG00000032599
AA Change: R273Q

DomainStartEndE-ValueType
Pfam:IPK 179 394 1.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194819
SMART Domains Protein: ENSMUSP00000141702
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 52 3.3e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195323
SMART Domains Protein: ENSMUSP00000141728
Gene: ENSMUSG00000032598

DomainStartEndE-ValueType
SH3 1 57 1.4e-11 SMART
Meta Mutation Damage Score 0.0919 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the inositol phosphokinase (IPK) family. This protein is likely responsible for the conversion of inositol hexakisphosphate (InsP6) to diphosphoinositol pentakisphosphate (InsP7/PP-InsP5). It may also convert 1,3,4,5,6-pentakisphosphate (InsP5) to PP-InsP4 and affect the growth suppressive and apoptotic activities of interferon-beta in some ovarian cancers. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele are resistant to radiation-induced mortality and show increased double-strand DNA break repair and incidence of induced aerodigestive tract carcinomas. Homozygotes for another null allele show increased B cell viability after radiation or neocarzinostatin treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Ip6k2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Ip6k2 APN 9 108805744 missense probably damaging 1.00
IGL01585:Ip6k2 APN 9 108796313 missense probably damaging 1.00
IGL02377:Ip6k2 APN 9 108804599 missense probably damaging 1.00
IGL02831:Ip6k2 APN 9 108804534 unclassified probably benign
banting UTSW 9 108805648 missense probably benign 0.07
R0310:Ip6k2 UTSW 9 108799233 splice site probably benign
R0541:Ip6k2 UTSW 9 108804627 missense probably damaging 1.00
R2378:Ip6k2 UTSW 9 108796301 unclassified probably null
R4119:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4120:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4231:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4232:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4235:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4236:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4327:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R4328:Ip6k2 UTSW 9 108805648 missense probably benign 0.07
R5019:Ip6k2 UTSW 9 108797746 intron probably benign
R5466:Ip6k2 UTSW 9 108798462 missense probably damaging 1.00
R6017:Ip6k2 UTSW 9 108797267 missense probably benign 0.01
R6688:Ip6k2 UTSW 9 108806011 missense probably benign 0.00
R6971:Ip6k2 UTSW 9 108797311 intron probably benign
R7150:Ip6k2 UTSW 9 108796731 missense unknown
R8007:Ip6k2 UTSW 9 108805756 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- GGGGACTTGAGTACAGTGACTG -3'
(R):5'- CTCCAAGTCCTCAGCATCTG -3'

Sequencing Primer
(F):5'- TGAACCTAGGTGATGGGACCTACTC -3'
(R):5'- ATCTGAGTCCAGGGTCACTTCTG -3'
Posted On2015-06-12