Incidental Mutation 'R4165:Prdm1'
ID321700
Institutional Source Beutler Lab
Gene Symbol Prdm1
Ensembl Gene ENSMUSG00000038151
Gene NamePR domain containing 1, with ZNF domain
SynonymsBlimp1, b2b1765Clo, Blimp-1, PRDI-BF1
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location44437177-44528501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44441576 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 417 (Y417F)
Ref Sequence ENSEMBL: ENSMUSP00000101129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039174] [ENSMUST00000105490] [ENSMUST00000218369]
Predicted Effect probably benign
Transcript: ENSMUST00000039174
AA Change: Y450F

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039248
Gene: ENSMUSG00000038151
AA Change: Y450F

DomainStartEndE-ValueType
SET 118 239 1.1e-19 SMART
low complexity region 359 393 N/A INTRINSIC
low complexity region 541 556 N/A INTRINSIC
ZnF_C2H2 606 628 6.42e-4 SMART
ZnF_C2H2 634 656 3.89e-3 SMART
ZnF_C2H2 662 684 7.26e-3 SMART
ZnF_C2H2 690 712 1.36e-2 SMART
ZnF_C2H2 718 738 1.12e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105490
AA Change: Y417F

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101129
Gene: ENSMUSG00000038151
AA Change: Y417F

DomainStartEndE-ValueType
SET 85 206 1.1e-19 SMART
low complexity region 326 360 N/A INTRINSIC
low complexity region 508 523 N/A INTRINSIC
ZnF_C2H2 573 595 6.42e-4 SMART
ZnF_C2H2 601 623 3.89e-3 SMART
ZnF_C2H2 629 651 7.26e-3 SMART
ZnF_C2H2 657 679 1.36e-2 SMART
ZnF_C2H2 685 705 1.12e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000218369
AA Change: Y432F

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.1514 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that acts as a repressor of beta-interferon gene expression. The protein binds specifically to the PRDI (positive regulatory domain I element) of the beta-IFN gene promoter. Transcription of this gene increases upon virus induction. Two alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality and impaired primordial germ cell development, while heterozygotes display a decreased numbers of primordial germ cells but normal migration. Conditional mutants display impaired plasma cell and pre-plasmamemory B cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Nr1d2 T C 14: 18,215,446 I189V probably benign Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Prdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00657:Prdm1 APN 10 44441892 missense probably damaging 1.00
IGL01331:Prdm1 APN 10 44441974 missense possibly damaging 0.67
IGL02064:Prdm1 APN 10 44441342 missense probably damaging 1.00
IGL02669:Prdm1 APN 10 44439884 missense probably benign 0.28
IGL02944:Prdm1 APN 10 44441811 missense probably benign
IGL03295:Prdm1 APN 10 44439870 missense probably damaging 0.99
PIT4576001:Prdm1 UTSW 10 44458508 start codon destroyed probably null 0.05
R0008:Prdm1 UTSW 10 44441679 missense probably damaging 1.00
R0166:Prdm1 UTSW 10 44440091 missense probably damaging 1.00
R0226:Prdm1 UTSW 10 44456696 missense probably benign 0.03
R0284:Prdm1 UTSW 10 44456626 missense probably damaging 1.00
R0398:Prdm1 UTSW 10 44439809 missense probably damaging 1.00
R1200:Prdm1 UTSW 10 44450130 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1405:Prdm1 UTSW 10 44439965 missense probably damaging 1.00
R1438:Prdm1 UTSW 10 44442128 missense probably benign 0.00
R1519:Prdm1 UTSW 10 44439986 nonsense probably null
R1886:Prdm1 UTSW 10 44439758 missense probably damaging 0.99
R2070:Prdm1 UTSW 10 44441412 missense possibly damaging 0.82
R2508:Prdm1 UTSW 10 44446807 missense probably benign 0.37
R3087:Prdm1 UTSW 10 44446827 missense probably damaging 1.00
R3150:Prdm1 UTSW 10 44458492 unclassified probably null
R4490:Prdm1 UTSW 10 44446907 nonsense probably null
R4647:Prdm1 UTSW 10 44439690 missense probably damaging 0.98
R4911:Prdm1 UTSW 10 44442052 missense possibly damaging 0.90
R4925:Prdm1 UTSW 10 44440169 missense probably damaging 1.00
R5153:Prdm1 UTSW 10 44450225 missense possibly damaging 0.94
R5247:Prdm1 UTSW 10 44440102 missense probably damaging 1.00
R5792:Prdm1 UTSW 10 44450228 missense probably damaging 1.00
R6164:Prdm1 UTSW 10 44450195 missense probably damaging 1.00
R6247:Prdm1 UTSW 10 44446786 splice site probably null
R7196:Prdm1 UTSW 10 44456992 missense probably benign 0.14
R7270:Prdm1 UTSW 10 44441570 missense probably benign 0.07
R7384:Prdm1 UTSW 10 44458507 missense probably benign 0.01
R7822:Prdm1 UTSW 10 44458482 missense probably benign 0.01
Z1088:Prdm1 UTSW 10 44441925 missense probably damaging 1.00
Z1176:Prdm1 UTSW 10 44446833 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATAAGCACCTCTTTGGGGTG -3'
(R):5'- CAGAGCCTTAAGAGCTCCAG -3'

Sequencing Primer
(F):5'- ACCTCTTTGGGGTGCTCCG -3'
(R):5'- GAAACACGGTGTCACCCCTG -3'
Posted On2015-06-12