Incidental Mutation 'R4165:Nr1d2'
ID321705
Institutional Source Beutler Lab
Gene Symbol Nr1d2
Ensembl Gene ENSMUSG00000021775
Gene Namenuclear receptor subfamily 1, group D, member 2
SynonymsRev-erb beta, RVR
MMRRC Submission 041007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4165 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location18204054-18239127 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18215446 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 189 (I189V)
Ref Sequence ENSEMBL: ENSMUSP00000088031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090543] [ENSMUST00000225491]
PDB Structure
[]
Predicted Effect probably benign
Transcript: ENSMUST00000090543
AA Change: I189V

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000088031
Gene: ENSMUSG00000021775
AA Change: I189V

DomainStartEndE-ValueType
low complexity region 13 47 N/A INTRINSIC
ZnF_C4 100 172 4.2e-38 SMART
Blast:HOLI 185 241 2e-13 BLAST
HOLI 404 562 3.71e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143308
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225308
Predicted Effect probably benign
Transcript: ENSMUST00000225491
Meta Mutation Damage Score 0.0791 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency 97% (38/39)
MGI Phenotype FUNCTION: This gene encodes a member of the nuclear hormone receptor family, specifically the NR1 subfamily of receptors. The encoded protein functions as a transcriptional repressor and may play a role in circadian rhythms and carbohydrate and lipid metabolism. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no gross abnormalities. Mice homozygous for a different knock-out allele display an increased anxiety-related response. A subset of mice homozygous for a third knock-out allele show neonatal lethality, atrioventricular septal defects (AVSDs) and related cardiovascular malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A T 9: 8,026,070 L167Q probably damaging Het
Aak1 T A 6: 86,850,062 F4I probably damaging Het
Adamts8 G T 9: 30,951,388 E296D probably benign Het
Alg11 T C 8: 22,065,557 V278A probably damaging Het
Ankfy1 G A 11: 72,714,484 probably null Het
Armc4 A T 18: 7,217,008 I668K probably damaging Het
Avil C T 10: 127,006,627 Q92* probably null Het
CK137956 A T 4: 127,970,729 S36T possibly damaging Het
Epb41l3 T C 17: 69,207,888 S7P probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Fsd2 T C 7: 81,545,860 T434A probably damaging Het
Gm5174 A G 10: 86,656,933 noncoding transcript Het
Gm8989 T A 7: 106,330,688 noncoding transcript Het
Gpaa1 A C 15: 76,332,467 probably benign Het
Grina T A 15: 76,249,329 L334Q probably damaging Het
Igkv15-103 G T 6: 68,437,840 G88* probably null Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm3b A T 18: 34,795,744 I183F probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Larp7 A G 3: 127,536,962 Y569H probably benign Het
Loxhd1 A T 18: 77,372,329 I758F probably damaging Het
Pcdhb19 T A 18: 37,499,190 N679K probably benign Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prap1 T A 7: 140,096,178 V35E probably benign Het
Prdm1 T A 10: 44,441,576 Y417F probably benign Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rps3 T C 7: 99,483,609 I5V probably benign Het
Sema3a A T 5: 13,473,397 probably null Het
Serpina3g A T 12: 104,240,287 T116S probably benign Het
Skint11 C A 4: 114,244,659 Q99K probably benign Het
Slc22a28 A G 19: 8,063,408 S493P possibly damaging Het
Snapc1 G T 12: 73,982,580 probably null Het
Sobp C T 10: 43,021,648 G647D probably damaging Het
Tomm22 C A 15: 79,671,005 probably benign Het
Trappc11 T C 8: 47,524,968 probably benign Het
Txnl4a T A 18: 80,222,256 M112K probably benign Het
Vmn2r16 T C 5: 109,330,561 F61L possibly damaging Het
Zfp709 C T 8: 71,890,805 Q693* probably null Het
Other mutations in Nr1d2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Nr1d2 APN 14 18215502 intron probably benign
IGL00897:Nr1d2 APN 14 18214993 missense probably benign 0.03
IGL02425:Nr1d2 APN 14 18222011 missense probably benign
IGL03039:Nr1d2 APN 14 18215184 missense probably benign 0.01
IGL03169:Nr1d2 APN 14 18216703 missense probably damaging 1.00
IGL03388:Nr1d2 APN 14 18215403 missense probably benign 0.02
R0173:Nr1d2 UTSW 14 18215502 intron probably benign
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0242:Nr1d2 UTSW 14 18211933 missense possibly damaging 0.80
R0674:Nr1d2 UTSW 14 18215086 missense probably benign 0.00
R1240:Nr1d2 UTSW 14 18211891 missense probably benign 0.04
R3115:Nr1d2 UTSW 14 18215504 splice site probably null
R3738:Nr1d2 UTSW 14 18211804 missense possibly damaging 0.74
R5319:Nr1d2 UTSW 14 18215197 missense probably benign 0.00
R5353:Nr1d2 UTSW 14 18222125 missense probably benign 0.05
R5384:Nr1d2 UTSW 14 18211922 missense probably benign 0.08
R5486:Nr1d2 UTSW 14 18206860 missense possibly damaging 0.65
R5827:Nr1d2 UTSW 14 18222248 missense possibly damaging 0.88
R7873:Nr1d2 UTSW 14 18216656 nonsense probably null
R8268:Nr1d2 UTSW 14 18216659 missense probably damaging 1.00
X0067:Nr1d2 UTSW 14 18211823 missense possibly damaging 0.60
Predicted Primers PCR Primer
(F):5'- TGGTCACCATACCAATCACTTC -3'
(R):5'- TTCCTTTACTGAATCAGTACCCAAG -3'

Sequencing Primer
(F):5'- CCTCCTTTGCAAAATCAGAAGGAGTG -3'
(R):5'- TTTACTGAATCAGTACCCAAGTTTAG -3'
Posted On2015-06-12