Incidental Mutation 'R4255:Terf1'
ID321758
Institutional Source Beutler Lab
Gene Symbol Terf1
Ensembl Gene ENSMUSG00000025925
Gene Nametelomeric repeat binding factor 1
SynonymsTrbf1, Trf1, Pin2
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4255 (G1)
Quality Score135
Status Validated
Chromosome1
Chromosomal Location15805646-15844052 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 15805679 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000140744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027057] [ENSMUST00000188371]
Predicted Effect probably null
Transcript: ENSMUST00000027057
AA Change: M1T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000027057
Gene: ENSMUSG00000025925
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TRF 61 257 2.3e-28 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186565
Predicted Effect probably null
Transcript: ENSMUST00000188371
AA Change: M1T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140744
Gene: ENSMUSG00000025925
AA Change: M1T

DomainStartEndE-ValueType
Pfam:TRF 61 258 3e-30 PFAM
SANT 366 417 1.9e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188684
Meta Mutation Damage Score 0.9556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to repeats in telomeres to form a nucleoprotein complex that protects against the degradation of chromosomal ends. The encoded protein regulates the length of telomeres and is an integral structural component of the functional telomere. This protein is thought to play a role in spindle formation in mitosis. Mutations in this gene are associated with bone marrow failure. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality and die sometime before E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Terf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02302:Terf1 APN 1 15833402 missense probably damaging 1.00
R0358:Terf1 UTSW 1 15805838 missense possibly damaging 0.84
R0369:Terf1 UTSW 1 15818983 missense probably damaging 1.00
R1471:Terf1 UTSW 1 15842970 missense probably damaging 1.00
R1853:Terf1 UTSW 1 15818938 nonsense probably null
R1942:Terf1 UTSW 1 15805814 missense probably benign 0.34
R2029:Terf1 UTSW 1 15805946 missense possibly damaging 0.82
R2132:Terf1 UTSW 1 15805685 missense probably benign 0.02
R2391:Terf1 UTSW 1 15805739 nonsense probably null
R4685:Terf1 UTSW 1 15818961 missense possibly damaging 0.80
R5291:Terf1 UTSW 1 15819086 splice site probably null
R5310:Terf1 UTSW 1 15805685 missense probably damaging 0.97
R5338:Terf1 UTSW 1 15831563 missense possibly damaging 0.48
R5661:Terf1 UTSW 1 15819664 missense probably damaging 1.00
R6216:Terf1 UTSW 1 15818997 missense probably benign 0.09
R6719:Terf1 UTSW 1 15838236 missense probably benign 0.01
R7126:Terf1 UTSW 1 15813139 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TATCCAAAACGCCTGGGCTC -3'
(R):5'- TGTCACGAGTACGACGAAAG -3'

Sequencing Primer
(F):5'- CTCGGATCGACAAGGAATTTAGC -3'
(R):5'- ACGAAAGTCCTCGGAGCG -3'
Posted On2015-06-20