Incidental Mutation 'R4255:Rabl6'
ID321765
Institutional Source Beutler Lab
Gene Symbol Rabl6
Ensembl Gene ENSMUSG00000015087
Gene NameRAB, member RAS oncogene family-like 6
SynonymsRbel1, Rbel1a, B230208H17Rik, Rbel1b
MMRRC Submission 041068-MU
Accession Numbers

Genbank: NM_001024616; MGI: 2442633

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location25583018-25608521 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25584779 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 640 (E640K)
Ref Sequence ENSEMBL: ENSMUSP00000058746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058137] [ENSMUST00000114217] [ENSMUST00000187017] [ENSMUST00000188161] [ENSMUST00000191602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058137
AA Change: E640K

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058746
Gene: ENSMUSG00000015087
AA Change: E640K

DomainStartEndE-ValueType
Pfam:Ras 45 108 1.5e-7 PFAM
Pfam:Roc 45 112 2.2e-8 PFAM
low complexity region 232 245 N/A INTRINSIC
low complexity region 291 325 N/A INTRINSIC
low complexity region 343 364 N/A INTRINSIC
low complexity region 378 397 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
coiled coil region 653 669 N/A INTRINSIC
low complexity region 708 720 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114217
SMART Domains Protein: ENSMUSP00000109855
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140635
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181730
Predicted Effect probably benign
Transcript: ENSMUST00000187017
Predicted Effect probably benign
Transcript: ENSMUST00000188161
SMART Domains Protein: ENSMUSP00000140763
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191602
SMART Domains Protein: ENSMUSP00000140109
Gene: ENSMUSG00000029419

DomainStartEndE-ValueType
low complexity region 61 92 N/A INTRINSIC
low complexity region 173 182 N/A INTRINSIC
low complexity region 271 284 N/A INTRINSIC
low complexity region 307 326 N/A INTRINSIC
low complexity region 617 636 N/A INTRINSIC
low complexity region 815 843 N/A INTRINSIC
low complexity region 880 894 N/A INTRINSIC
Meta Mutation Damage Score 0.0748 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ras superfamily of small GTPases. The encoded protein binds to both GTP and GDP and may play a role in cell growth and survival. Overexpression of this gene may play a role in breast cancer tumorigenesis, and pseudogenes of this gene are located on the long arm of chromosome 2 and the short arm of chromosome 18. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Rabl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Rabl6 APN 2 25584120 unclassified probably benign
IGL00742:Rabl6 APN 2 25588687 missense probably damaging 0.96
IGL02231:Rabl6 APN 2 25598184 missense probably benign 0.41
IGL02424:Rabl6 APN 2 25587457 missense probably benign
IGL02514:Rabl6 APN 2 25608176 missense probably damaging 0.96
IGL03036:Rabl6 APN 2 25584856 missense probably benign 0.00
IGL03278:Rabl6 APN 2 25583822 unclassified probably benign
R0017:Rabl6 UTSW 2 25602567 splice site probably benign
R0269:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0442:Rabl6 UTSW 2 25587522 missense probably damaging 0.98
R0617:Rabl6 UTSW 2 25586866 critical splice donor site probably null
R0626:Rabl6 UTSW 2 25592766 critical splice donor site probably null
R1109:Rabl6 UTSW 2 25587526 missense probably damaging 1.00
R2034:Rabl6 UTSW 2 25585432 missense possibly damaging 0.59
R3914:Rabl6 UTSW 2 25588706 missense possibly damaging 0.91
R5177:Rabl6 UTSW 2 25585373 missense probably benign 0.18
R5389:Rabl6 UTSW 2 25588654 missense probably damaging 0.96
R6082:Rabl6 UTSW 2 25583825 unclassified probably benign
R6243:Rabl6 UTSW 2 25585403 missense probably damaging 0.98
R6430:Rabl6 UTSW 2 25584837 missense probably damaging 0.96
R6501:Rabl6 UTSW 2 25602447 missense possibly damaging 0.92
R7485:Rabl6 UTSW 2 25584141 missense unknown
R7839:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7889:Rabl6 UTSW 2 25584774 critical splice donor site probably null
R7922:Rabl6 UTSW 2 25592817 missense probably damaging 0.97
R7972:Rabl6 UTSW 2 25584774 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGACTATTCTGGACCACACTTG -3'
(R):5'- TCGTAAGTGAACTTGCCAACC -3'

Sequencing Primer
(F):5'- CACACTTGGGTGCACATTTG -3'
(R):5'- GTAAGTGAACTTGCCAACCTTGTTTC -3'
Posted On2015-06-20