Incidental Mutation 'R4255:Actc1'
ID321770
Institutional Source Beutler Lab
Gene Symbol Actc1
Ensembl Gene ENSMUSG00000068614
Gene Nameactin, alpha, cardiac muscle 1
Synonymsalphac-actin, Actc-1
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location114047282-114053548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114049216 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 254 (N254S)
Ref Sequence ENSEMBL: ENSMUSP00000087736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090269] [ENSMUST00000149125]
Predicted Effect probably benign
Transcript: ENSMUST00000090269
AA Change: N254S

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000087736
Gene: ENSMUSG00000068614
AA Change: N254S

DomainStartEndE-ValueType
ACTIN 7 377 4.38e-238 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131299
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140041
Predicted Effect probably benign
Transcript: ENSMUST00000149125
Meta Mutation Damage Score 0.1163 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Actins are highly conserved proteins that are involved in various types of cell motility. Polymerization of globular actin (G-actin) leads to a structural filament (F-actin) in the form of a two-stranded helix. Each actin can bind to four others. The protein encoded by this gene belongs to the actin family which is comprised of three main groups of actin isoforms, alpha, beta, and gamma. The alpha actins are found in muscle tissues and are a major constituent of the contractile apparatus. Defects in this gene have been associated with idiopathic dilated cardiomyopathy (IDC) and familial hypertrophic cardiomyopathy (FHC). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutation of this gene results in embryonic and postnatal lethality. Animals that survive to birth die within the first 2 weeks and display reduced body size and heart muscle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Actc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Actc1 APN 2 114048113 unclassified probably benign
IGL02985:Actc1 APN 2 114048160 missense probably damaging 1.00
IGL03204:Actc1 APN 2 114049530 missense possibly damaging 0.57
R1201:Actc1 UTSW 2 114049513 critical splice donor site probably null
R1463:Actc1 UTSW 2 114049529 missense probably damaging 1.00
R4476:Actc1 UTSW 2 114049226 missense probably benign
R4581:Actc1 UTSW 2 114049608 missense possibly damaging 0.88
R5466:Actc1 UTSW 2 114050498 missense probably damaging 0.99
R6395:Actc1 UTSW 2 114049250 nonsense probably null
Z1176:Actc1 UTSW 2 114051997 missense probably benign 0.00
Z1177:Actc1 UTSW 2 114047513 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCACTAGAGCGCCTTGGTC -3'
(R):5'- TTGACTATGAAGCCCTCTGTC -3'

Sequencing Primer
(F):5'- TATCAGGAGGTGAGACTGAGCTG -3'
(R):5'- CTCTGCAGCTGAACGTGAAATTG -3'
Posted On2015-06-20