Mutagenetix > Incidental Mutations

Incidental Mutation 'R4255:Brca2'

321778

Institutional Source

Beutler Lab

Gene Symbol

Brca2

Ensembl Gene

ENSMUSG00000041147

Gene Name

breast cancer 2, early onset

Synonyms

Fancd1, RAB163

MMRRC Submission

041068-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4255 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

150522630-150570329 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 150541169 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 1466 (E1466G)

Ref Sequence

ENSEMBL: ENSMUSP00000144150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044620] [ENSMUST00000202003] [ENSMUST00000202313]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000044620
AA Change: E1466G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038576
Gene: ENSMUSG00000041147
AA Change: E1466G

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000202003

SMART Domains

Protein: ENSMUSP00000144676
Gene: ENSMUSG00000041147

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000202313
AA Change: E1466G

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000144150
Gene: ENSMUSG00000041147
AA Change: E1466G

Domain	Start	End	E-Value	Type
low complexity region	36	51	N/A	INTRINSIC
low complexity region	100	123	N/A	INTRINSIC
low complexity region	187	199	N/A	INTRINSIC
low complexity region	746	761	N/A	INTRINSIC
low complexity region	904	917	N/A	INTRINSIC
Pfam:BRCA2	982	1014	2.6e-13	PFAM
Pfam:BRCA2	1193	1225	3.9e-16	PFAM
low complexity region	1239	1252	N/A	INTRINSIC
Pfam:BRCA2	1395	1425	1.4e-13	PFAM
Pfam:BRCA2	1492	1524	1.8e-13	PFAM
Pfam:BRCA2	1624	1655	8.4e-12	PFAM
Pfam:BRCA2	1925	1957	8e-15	PFAM
Pfam:BRCA2	2005	2037	1.7e-11	PFAM
Pfam:BRCA-2_helical	2402	2588	1.3e-94	PFAM
Pfam:BRCA-2_OB1	2591	2717	5.3e-44	PFAM
Tower	2752	2793	2.37e-18	SMART
Pfam:BRCA-2_OB3	2971	3104	1.5e-49	PFAM
low complexity region	3197	3208	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202975

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

93% (50/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Inherited mutations in BRCA1 and this gene, BRCA2, confer increased lifetime risk of developing breast or ovarian cancer. Both BRCA1 and BRCA2 are involved in maintenance of genome stability, specifically the homologous recombination pathway for double-strand DNA repair. The BRCA2 protein contains several copies of a 70 aa motif called the BRC motif, and these motifs mediate binding to the RAD51 recombinase which functions in DNA repair. BRCA2 is considered a tumor suppressor gene, as tumors with BRCA2 mutations generally exhibit loss of heterozygosity (LOH) of the wild-type allele. [provided by RefSeq, Dec 2008]
PHENOTYPE: Homozygous null mutants are embryonic lethal with abnormalities including growth retardation, neural tube defects, and mesoderm abnormalities; conditional mutations cause genetic instability and enhanced tumor formation; mutants with truncated BRCA2 protein survive, are small, infertile, show improper tissue differentiation and develop lymphomas and carcinomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	T	C	2: 69,306,605	I171V	probably benign	Het
Actc1	T	C	2: 114,049,216	N254S	probably benign	Het
Adgrg1	T	G	8: 95,005,902		probably null	Het
Ankrd7	T	A	6: 18,869,881		probably null	Het
Baz2b	T	C	2: 59,920,572		probably benign	Het
C87977	T	A	4: 144,207,484	D351V	possibly damaging	Het
Dagla	G	A	19: 10,256,952	R332*	probably null	Het
Dnah5	T	A	15: 28,438,102	S3960T	probably benign	Het
Dnhd1	T	A	7: 105,712,998	L3689M	probably damaging	Het
Epn1	T	A	7: 5,097,638	L530Q	probably damaging	Het
Fgf17	C	A	14: 70,641,722		probably null	Het
Fgfr4	G	A	13: 55,166,251	V593M	probably damaging	Het
Fmo4	A	G	1: 162,794,326	C439R	probably benign	Het
Fndc3b	T	C	3: 27,501,407	K333E	possibly damaging	Het
Gpc6	A	G	14: 117,951,141	T396A	probably benign	Het
Igkv3-2	T	A	6: 70,699,061	V118D	probably benign	Het
Mtbp	C	A	15: 55,620,685	S470R	possibly damaging	Het
Myh8	A	G	11: 67,299,734	D1295G	probably benign	Het
Myo1h	T	C	5: 114,330,137	I331T	possibly damaging	Het
Myo7a	T	G	7: 98,071,964	M1265L	probably damaging	Het
Olfr1394	G	A	11: 49,160,435	W140*	probably null	Het
Olfr320	A	T	11: 58,683,965	I31F	probably damaging	Het
Olfr46	C	A	7: 140,610,587	Y132*	probably null	Het
Pak1ip1	A	G	13: 41,011,156		probably benign	Het
Pcdha11	A	G	18: 37,012,790	T645A	probably benign	Het
Peg12	A	G	7: 62,463,731	I206T	possibly damaging	Het
Pkhd1	A	G	1: 20,593,934	V140A	probably damaging	Het
Prrc2c	C	A	1: 162,706,326		probably benign	Het
Ptprk	A	G	10: 28,206,245	E70G	probably benign	Het
Rabl6	C	T	2: 25,584,779	E640K	possibly damaging	Het
Rasd2	G	A	8: 75,221,910	E155K	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Sdf4	A	G	4: 156,000,757	H183R	probably benign	Het
Slc12a9	C	T	5: 137,321,432	R607H	probably damaging	Het
Slc38a1	T	C	15: 96,585,550	D299G	probably benign	Het
Slc4a10	A	G	2: 62,281,936	N657S	probably benign	Het
Spata31d1c	C	G	13: 65,035,688	S348*	probably null	Het
Spata31d1c	T	C	13: 65,035,717	F358L	probably benign	Het
Srbd1	A	T	17: 86,102,922	S527R	possibly damaging	Het
Stag3	T	C	5: 138,290,881	V243A	probably damaging	Het
Tefm	A	T	11: 80,140,249	S54T	probably damaging	Het
Terf1	T	C	1: 15,805,679	M1T	probably null	Het
Thsd7b	G	A	1: 129,760,287	S645N	possibly damaging	Het
Trmt13	G	T	3: 116,582,688	S285*	probably null	Het
Ttn	A	T	2: 76,811,243	L5176Q	possibly damaging	Het
Ush2a	C	T	1: 188,759,843	R3110*	probably null	Het
Vnn3	T	C	10: 23,865,822	Y342H	probably benign	Het

Other mutations in Brca2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Brca2	APN	5	150539898	missense	probably benign	0.18
IGL00392:Brca2	APN	5	150541240	missense	probably benign	0.02
IGL00557:Brca2	APN	5	150560538	missense	probably benign
IGL00798:Brca2	APN	5	150539463	missense	probably benign	0.30
IGL00933:Brca2	APN	5	150542404	missense	probably benign	0.04
IGL00964:Brca2	APN	5	150532310	missense	probably damaging	1.00
IGL01152:Brca2	APN	5	150542390	missense	probably damaging	0.99
IGL01577:Brca2	APN	5	150541620	nonsense	probably null
IGL01585:Brca2	APN	5	150539516	missense	possibly damaging	0.76
IGL01732:Brca2	APN	5	150542387	missense	probably benign	0.13
IGL01809:Brca2	APN	5	150531061	splice site	probably null
IGL01911:Brca2	APN	5	150567613	missense	probably damaging	0.96
IGL02113:Brca2	APN	5	150540979	missense	possibly damaging	0.95
IGL02313:Brca2	APN	5	150538661	missense	probably damaging	1.00
IGL02342:Brca2	APN	5	150542824	missense	possibly damaging	0.94
IGL02508:Brca2	APN	5	150543308	missense	possibly damaging	0.85
IGL02532:Brca2	APN	5	150550862	missense	probably damaging	1.00
IGL02646:Brca2	APN	5	150560790	missense	possibly damaging	0.89
IGL02738:Brca2	APN	5	150567035	missense	probably damaging	1.00
IGL02833:Brca2	APN	5	150541790	missense	possibly damaging	0.83
IGL02871:Brca2	APN	5	150542552	missense	probably benign	0.13
IGL02995:Brca2	APN	5	150529488	missense	probably damaging	1.00
IGL03105:Brca2	APN	5	150560485	missense	probably benign	0.02
BB007:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
BB017:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R0219:Brca2	UTSW	5	150523175	splice site	probably benign
R0416:Brca2	UTSW	5	150569392	missense	possibly damaging	0.93
R0441:Brca2	UTSW	5	150541857	missense	probably damaging	0.96
R0548:Brca2	UTSW	5	150544935	missense	probably damaging	0.96
R0745:Brca2	UTSW	5	150544882	splice site	probably benign
R0799:Brca2	UTSW	5	150560193	missense	probably damaging	0.99
R1165:Brca2	UTSW	5	150542747	missense	probably damaging	0.98
R1247:Brca2	UTSW	5	150541274	missense	probably damaging	1.00
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1403:Brca2	UTSW	5	150542649	missense	probably benign	0.22
R1444:Brca2	UTSW	5	150542450	missense	probably benign
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1466:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1584:Brca2	UTSW	5	150552258	missense	probably damaging	0.99
R1599:Brca2	UTSW	5	150548713	nonsense	probably null
R1600:Brca2	UTSW	5	150560830	splice site	probably benign
R1822:Brca2	UTSW	5	150540198	missense	probably benign	0.06
R1824:Brca2	UTSW	5	150536922	missense	possibly damaging	0.94
R2037:Brca2	UTSW	5	150540669	missense	probably benign
R2131:Brca2	UTSW	5	150557129	missense	probably damaging	1.00
R2203:Brca2	UTSW	5	150539502	missense	possibly damaging	0.58
R2208:Brca2	UTSW	5	150532344	missense	probably damaging	0.96
R2293:Brca2	UTSW	5	150560534	missense	possibly damaging	0.86
R2517:Brca2	UTSW	5	150539672	missense	probably benign	0.04
R2566:Brca2	UTSW	5	150541762	missense	probably benign	0.03
R3422:Brca2	UTSW	5	150543121	missense	possibly damaging	0.91
R3917:Brca2	UTSW	5	150540827	missense	probably damaging	0.96
R3946:Brca2	UTSW	5	150536704	missense	probably damaging	0.96
R4176:Brca2	UTSW	5	150539633	nonsense	probably null
R4450:Brca2	UTSW	5	150536053	missense	probably damaging	0.96
R4603:Brca2	UTSW	5	150536165	missense	possibly damaging	0.86
R4681:Brca2	UTSW	5	150552398	splice site	probably null
R4755:Brca2	UTSW	5	150559987	splice site	probably null
R4762:Brca2	UTSW	5	150531116	missense	probably benign	0.00
R4824:Brca2	UTSW	5	150539735	missense	probably damaging	1.00
R4887:Brca2	UTSW	5	150556937	missense	probably damaging	1.00
R5020:Brca2	UTSW	5	150560436	missense	probably damaging	1.00
R5159:Brca2	UTSW	5	150542108	missense	possibly damaging	0.93
R5216:Brca2	UTSW	5	150542980	missense	probably damaging	0.99
R5269:Brca2	UTSW	5	150539223	missense	possibly damaging	0.75
R5274:Brca2	UTSW	5	150539689	missense	probably benign	0.00
R5589:Brca2	UTSW	5	150557132	missense	possibly damaging	0.67
R5619:Brca2	UTSW	5	150557114	missense	probably damaging	0.96
R5641:Brca2	UTSW	5	150556899	missense	probably damaging	1.00
R5686:Brca2	UTSW	5	150540904	missense	probably benign	0.00
R5730:Brca2	UTSW	5	150569005	missense	possibly damaging	0.85
R5763:Brca2	UTSW	5	150548006	missense	possibly damaging	0.85
R5877:Brca2	UTSW	5	150543221	missense	possibly damaging	0.53
R5893:Brca2	UTSW	5	150569138	missense	probably benign	0.02
R5900:Brca2	UTSW	5	150541132	missense	probably benign	0.01
R5926:Brca2	UTSW	5	150534622	missense	probably benign	0.07
R5966:Brca2	UTSW	5	150543251	missense	probably damaging	0.99
R6025:Brca2	UTSW	5	150541575	frame shift	probably null
R6062:Brca2	UTSW	5	150556889	missense	probably damaging	0.96
R6141:Brca2	UTSW	5	150540637	missense	possibly damaging	0.91
R6244:Brca2	UTSW	5	150566978	missense	probably benign	0.08
R6508:Brca2	UTSW	5	150536593	missense	possibly damaging	0.91
R6519:Brca2	UTSW	5	150540979	missense	probably damaging	0.99
R6611:Brca2	UTSW	5	150536193	missense	probably damaging	0.99
R6698:Brca2	UTSW	5	150532394	missense	probably damaging	1.00
R6856:Brca2	UTSW	5	150540208	missense	possibly damaging	0.68
R6912:Brca2	UTSW	5	150541742	missense	probably damaging	0.99
R7002:Brca2	UTSW	5	150539918	missense	probably benign
R7025:Brca2	UTSW	5	150540478	missense	probably benign	0.39
R7151:Brca2	UTSW	5	150541436	missense	probably benign	0.12
R7202:Brca2	UTSW	5	150532354	missense	probably benign	0.03
R7365:Brca2	UTSW	5	150532337	missense	probably damaging	0.99
R7510:Brca2	UTSW	5	150536691	missense	possibly damaging	0.85
R7612:Brca2	UTSW	5	150540611	missense	probably benign	0.03
R7682:Brca2	UTSW	5	150543153	missense	probably benign
R7890:Brca2	UTSW	5	150539381	missense	possibly damaging	0.83
R7930:Brca2	UTSW	5	150558510	missense	probably damaging	0.96
R7940:Brca2	UTSW	5	150538733	missense	probably benign
R8054:Brca2	UTSW	5	150536504	missense	probably benign	0.02
R8056:Brca2	UTSW	5	150569306	missense	possibly damaging	0.85
R8080:Brca2	UTSW	5	150539892	missense	probably benign	0.11
R8094:Brca2	UTSW	5	150536169	missense	possibly damaging	0.85
R8306:Brca2	UTSW	5	150536663	missense	possibly damaging	0.91
R8401:Brca2	UTSW	5	150552352	missense	probably damaging	1.00
R8523:Brca2	UTSW	5	150560148	missense	possibly damaging	0.75
R8784:Brca2	UTSW	5	150548661	nonsense	probably null
R8791:Brca2	UTSW	5	150542596	missense	possibly damaging	0.92
Z1088:Brca2	UTSW	5	150542763	missense	probably damaging	0.96
Z1186:Brca2	UTSW	5	150536583	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCCTTTCAGACTGCAAGTGGG -3'
(R):5'- GATCCTTGACTAAAACTGGCAG -3'

Sequencing Primer
(F):5'- TGGGAAAAATACCAGAGTCTCC -3'
(R):5'- GGCAGTTTTCCTAACATATTGTGTC -3'

Posted On

2015-06-20