Incidental Mutation 'R4255:Olfr46'
ID321785
Institutional Source Beutler Lab
Gene Symbol Olfr46
Ensembl Gene ENSMUSG00000093942
Gene Nameolfactory receptor 46
SynonymsID12, IF5, MOR253-8, GA_x6K02T2PBJ9-42759973-42760905, IB7
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location140601269-140617678 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 140610587 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 132 (Y132*)
Ref Sequence ENSEMBL: ENSMUSP00000149158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072655] [ENSMUST00000211771] [ENSMUST00000214180]
Predicted Effect probably null
Transcript: ENSMUST00000072655
AA Change: Y140*
SMART Domains Protein: ENSMUSP00000072445
Gene: ENSMUSG00000093942
AA Change: Y140*

DomainStartEndE-ValueType
Pfam:7tm_4 39 315 1.1e-50 PFAM
Pfam:7TM_GPCR_Srsx 43 209 5.9e-8 PFAM
Pfam:7tm_1 49 298 3.4e-21 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000211771
AA Change: Y132*
Predicted Effect probably null
Transcript: ENSMUST00000214180
AA Change: Y132*
Meta Mutation Damage Score 0.9660 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Olfr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Olfr46 APN 7 140610753 missense probably damaging 1.00
IGL02408:Olfr46 APN 7 140610931 missense probably damaging 1.00
IGL02496:Olfr46 APN 7 140610168 start codon destroyed probably benign
IGL03003:Olfr46 APN 7 140610370 missense probably damaging 1.00
R0538:Olfr46 UTSW 7 140610384 missense probably damaging 1.00
R1350:Olfr46 UTSW 7 140610709 missense probably damaging 0.96
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R1466:Olfr46 UTSW 7 140610969 missense probably benign 0.01
R2008:Olfr46 UTSW 7 140610585 missense probably damaging 1.00
R4110:Olfr46 UTSW 7 140610264 missense probably benign 0.20
R4110:Olfr46 UTSW 7 140610265 missense possibly damaging 0.89
R4622:Olfr46 UTSW 7 140610698 nonsense probably null
R4809:Olfr46 UTSW 7 140611074 missense probably damaging 0.98
R4826:Olfr46 UTSW 7 140610319 missense probably benign 0.02
R4989:Olfr46 UTSW 7 140610391 missense possibly damaging 0.95
R5177:Olfr46 UTSW 7 140610189 missense probably benign 0.00
R5261:Olfr46 UTSW 7 140610663 missense probably benign 0.00
R5770:Olfr46 UTSW 7 140610943 missense probably damaging 1.00
R5863:Olfr46 UTSW 7 140610631 missense probably damaging 0.97
R6082:Olfr46 UTSW 7 140610681 missense probably benign 0.00
R6705:Olfr46 UTSW 7 140610784 missense probably damaging 0.99
R7216:Olfr46 UTSW 7 140610460 missense possibly damaging 0.87
R7443:Olfr46 UTSW 7 140611048 missense probably damaging 1.00
R7485:Olfr46 UTSW 7 140610178 missense probably benign 0.02
R7806:Olfr46 UTSW 7 140610772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCGACCATGGATATTATCTGCAC -3'
(R):5'- TGCCACAAGAGTCATAACGC -3'

Sequencing Primer
(F):5'- ATGGATATTATCTGCACCTCCTCTG -3'
(R):5'- AGAATGACAGCCGTGTCA -3'
Posted On2015-06-20