Incidental Mutation 'R4255:Adgrg1'
ID321788
Institutional Source Beutler Lab
Gene Symbol Adgrg1
Ensembl Gene ENSMUSG00000031785
Gene Nameadhesion G protein-coupled receptor G1
SynonymsCyt28, Gpr56
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location94974751-95014217 bp(+) (GRCm38)
Type of Mutationunclassified (2 bp from exon)
DNA Base Change (assembly) T to G at 95005902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000148331 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093271] [ENSMUST00000179619] [ENSMUST00000211944] [ENSMUST00000211984] [ENSMUST00000212118] [ENSMUST00000212141] [ENSMUST00000212531] [ENSMUST00000212581] [ENSMUST00000212660] [ENSMUST00000212799] [ENSMUST00000212956] [ENSMUST00000212976] [ENSMUST00000212995]
Predicted Effect probably null
Transcript: ENSMUST00000093271
SMART Domains Protein: ENSMUSP00000090959
Gene: ENSMUSG00000031785

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 8.1e-32 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000179619
SMART Domains Protein: ENSMUSP00000137520
Gene: ENSMUSG00000031785

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
GPS 342 394 1.42e-12 SMART
Pfam:7tm_2 400 648 3.4e-31 PFAM
low complexity region 678 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211850
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211911
Predicted Effect probably benign
Transcript: ENSMUST00000211944
Predicted Effect probably benign
Transcript: ENSMUST00000211984
Predicted Effect probably benign
Transcript: ENSMUST00000212118
Predicted Effect probably null
Transcript: ENSMUST00000212141
Predicted Effect probably benign
Transcript: ENSMUST00000212531
Predicted Effect probably benign
Transcript: ENSMUST00000212581
Predicted Effect probably benign
Transcript: ENSMUST00000212660
Predicted Effect probably benign
Transcript: ENSMUST00000212799
Predicted Effect probably benign
Transcript: ENSMUST00000212956
Predicted Effect probably benign
Transcript: ENSMUST00000212976
Predicted Effect probably benign
Transcript: ENSMUST00000212995
Meta Mutation Damage Score 0.9363 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled receptor family and regulates brain cortical patterning. The encoded protein binds specifically to transglutaminase 2, a component of tissue and tumor stroma implicated as an inhibitor of tumor progression. Mutations in this gene are associated with a brain malformation known as bilateral frontoparietal polymicrogyria. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit neuronal ectopias in the frontoparietal cortex due to disruptions in the pial basement membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Adgrg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00983:Adgrg1 APN 8 95005243 missense probably damaging 1.00
IGL01138:Adgrg1 APN 8 95003457 missense probably damaging 1.00
IGL01806:Adgrg1 APN 8 95012931 missense probably damaging 1.00
IGL02229:Adgrg1 APN 8 95003511 missense probably damaging 1.00
IGL03109:Adgrg1 APN 8 95007676 unclassified probably benign
D4043:Adgrg1 UTSW 8 95005229 unclassified probably null
R0383:Adgrg1 UTSW 8 95011742 missense probably damaging 1.00
R1155:Adgrg1 UTSW 8 95006840 missense possibly damaging 0.92
R1656:Adgrg1 UTSW 8 95011810 nonsense probably null
R1944:Adgrg1 UTSW 8 95007300 missense probably damaging 0.99
R1952:Adgrg1 UTSW 8 95008491 critical splice donor site probably null
R2408:Adgrg1 UTSW 8 95003493 missense probably null 1.00
R3776:Adgrg1 UTSW 8 95009655 missense probably damaging 0.99
R3813:Adgrg1 UTSW 8 95011565 missense probably benign 0.34
R4254:Adgrg1 UTSW 8 95005902 unclassified probably null
R4951:Adgrg1 UTSW 8 95005246 missense probably damaging 1.00
R4997:Adgrg1 UTSW 8 95009520 missense probably damaging 1.00
R5152:Adgrg1 UTSW 8 95009745 missense probably damaging 1.00
R6122:Adgrg1 UTSW 8 95002501 missense probably benign 0.45
R6897:Adgrg1 UTSW 8 95002498 missense probably benign
R7446:Adgrg1 UTSW 8 95011784 missense probably damaging 1.00
R7736:Adgrg1 UTSW 8 95005337 missense probably benign
R7784:Adgrg1 UTSW 8 95012882 nonsense probably null
Z1177:Adgrg1 UTSW 8 95007630 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTGTATCTAGACCATCACCAC -3'
(R):5'- TCTAAACACTGGGCTCTGGG -3'

Sequencing Primer
(F):5'- GTGTATCTAGACCATCACCACTACCC -3'
(R):5'- CCACAAGAGACCAGGGAGTC -3'
Posted On2015-06-20