Incidental Mutation 'R4255:Vnn3'
ID321789
Institutional Source Beutler Lab
Gene Symbol Vnn3
Ensembl Gene ENSMUSG00000020010
Gene Namevanin 3
Synonyms
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location23851462-23869843 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23865822 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 342 (Y342H)
Ref Sequence ENSEMBL: ENSMUSP00000020190 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020190]
Predicted Effect probably benign
Transcript: ENSMUST00000020190
AA Change: Y342H

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020190
Gene: ENSMUSG00000020010
AA Change: Y342H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:CN_hydrolase 51 296 6.9e-19 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Other mutations in Vnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Vnn3 APN 10 23867168 missense possibly damaging 0.77
IGL01300:Vnn3 APN 10 23864365 missense possibly damaging 0.87
IGL01349:Vnn3 APN 10 23851916 missense probably damaging 0.99
IGL02491:Vnn3 APN 10 23865918 missense probably benign 0.11
IGL03256:Vnn3 APN 10 23851800 splice site probably benign
IGL03289:Vnn3 APN 10 23865837 missense possibly damaging 0.92
IGL02799:Vnn3 UTSW 10 23851971 missense possibly damaging 0.64
R0599:Vnn3 UTSW 10 23865705 missense possibly damaging 0.94
R1703:Vnn3 UTSW 10 23865930 missense probably benign
R1753:Vnn3 UTSW 10 23865820 missense probably benign 0.27
R2119:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R2288:Vnn3 UTSW 10 23864456 missense probably benign 0.03
R4458:Vnn3 UTSW 10 23865669 missense probably benign 0.23
R4518:Vnn3 UTSW 10 23867226 missense possibly damaging 0.77
R4545:Vnn3 UTSW 10 23856326 missense probably benign 0.00
R4723:Vnn3 UTSW 10 23851691 missense possibly damaging 0.88
R4791:Vnn3 UTSW 10 23864621 missense probably benign
R4921:Vnn3 UTSW 10 23864575 missense probably benign 0.01
R5152:Vnn3 UTSW 10 23864339 missense probably benign 0.01
R5390:Vnn3 UTSW 10 23851585 start codon destroyed probably null 1.00
R5545:Vnn3 UTSW 10 23867094 missense probably benign 0.00
R6197:Vnn3 UTSW 10 23856289 missense probably damaging 1.00
R6751:Vnn3 UTSW 10 23869625 missense probably benign 0.00
R6846:Vnn3 UTSW 10 23851722 missense probably benign
R6917:Vnn3 UTSW 10 23865934 missense possibly damaging 0.50
R7073:Vnn3 UTSW 10 23864413 missense probably damaging 1.00
R7100:Vnn3 UTSW 10 23865942 missense probably damaging 1.00
R7152:Vnn3 UTSW 10 23851615 missense possibly damaging 0.88
R7336:Vnn3 UTSW 10 23851908 missense probably benign 0.42
R7421:Vnn3 UTSW 10 23865768 missense probably benign 0.06
R7875:Vnn3 UTSW 10 23867248 missense possibly damaging 0.80
R7958:Vnn3 UTSW 10 23867248 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- CAACATTTGCGATCCGTTATCC -3'
(R):5'- GGTAATACTGGCCTTCCACTGTATG -3'

Sequencing Primer
(F):5'- TGGAATCTACAGCCCGGAAGC -3'
(R):5'- CACTGTATGGAGTCCATCAAAGGC -3'
Posted On2015-06-20