Incidental Mutation 'R4255:Olfr320'
ID321792
Institutional Source Beutler Lab
Gene Symbol Olfr320
Ensembl Gene ENSMUSG00000107711
Gene Nameolfactory receptor 320
SynonymsGA_x6K02T2NKPP-730312-729392, GA_x6K02T2NKPP-733777-732813, MOR285-4, MOR285-5, Olfr320, Olfr321-ps1
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58681099-58686233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58683965 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 31 (I31F)
Ref Sequence ENSEMBL: ENSMUSP00000150051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000204718] [ENSMUST00000214662]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122047
Predicted Effect probably damaging
Transcript: ENSMUST00000190555
AA Change: I31F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140968
Gene: ENSMUSG00000100688
AA Change: I31F

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.7e-28 PFAM
Pfam:7tm_4 139 283 4.1e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204718
AA Change: I31F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000145531
Gene: ENSMUSG00000107711
AA Change: I31F

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 8.4e-45 PFAM
Pfam:7tm_1 41 290 1.1e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214662
AA Change: I31F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.1925 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Olfr320
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Olfr320 APN 11 58684269 missense probably damaging 1.00
IGL02293:Olfr320 APN 11 58684170 missense probably benign 0.01
IGL03001:Olfr320 APN 11 58683876 start codon destroyed probably null 1.00
IGL03039:Olfr320 APN 11 58684011 missense probably damaging 0.98
R0064:Olfr320 UTSW 11 58684475 missense probably benign 0.00
R1506:Olfr320 UTSW 11 58684188 missense probably benign 0.13
R4345:Olfr320 UTSW 11 58683945 missense possibly damaging 0.63
R4646:Olfr320 UTSW 11 58684730 missense probably damaging 0.99
R4951:Olfr320 UTSW 11 58684763 missense probably damaging 0.98
R5591:Olfr320 UTSW 11 58684125 missense probably benign 0.36
R6244:Olfr320 UTSW 11 58684004 missense possibly damaging 0.53
R6325:Olfr320 UTSW 11 58684528 nonsense probably null
R7894:Olfr320 UTSW 11 58684674 missense possibly damaging 0.94
R7977:Olfr320 UTSW 11 58684674 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGTGCCCTAGAGCTATTCAG -3'
(R):5'- AAATGGCCTTGGTGTCTGAG -3'

Sequencing Primer
(F):5'- TGCCCTAGAGCTATTCAGGGAAAC -3'
(R):5'- TCTGAGAGGAAGTTAGCTGCC -3'
Posted On2015-06-20