Incidental Mutation 'R4255:Pak1ip1'
ID321795
Institutional Source Beutler Lab
Gene Symbol Pak1ip1
Ensembl Gene ENSMUSG00000038683
Gene NamePAK1 interacting protein 1
Synonyms5830431I15Rik, Gdpd1, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location41001023-41013015 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 41011156 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000040846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046951]
Predicted Effect probably benign
Transcript: ENSMUST00000046951
SMART Domains Protein: ENSMUSP00000040846
Gene: ENSMUSG00000038683

DomainStartEndE-ValueType
WD40 29 68 6.89e-3 SMART
WD40 71 109 1.19e-6 SMART
WD40 112 151 1.59e-7 SMART
Blast:WD40 156 190 4e-10 BLAST
WD40 194 231 3.45e-1 SMART
WD40 234 275 6.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174551
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU mutagenesis exhibit median orofacial clefting, developmental delay and death around E14. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Pak1ip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Pak1ip1 APN 13 41008018 missense possibly damaging 0.66
IGL00848:Pak1ip1 APN 13 41012623 missense probably benign 0.18
IGL02327:Pak1ip1 APN 13 41012417 missense probably benign
R0383:Pak1ip1 UTSW 13 41012604 missense probably benign 0.00
R1706:Pak1ip1 UTSW 13 41012688 missense probably benign 0.00
R1851:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R1852:Pak1ip1 UTSW 13 41011232 missense possibly damaging 0.90
R4326:Pak1ip1 UTSW 13 41004756 missense possibly damaging 0.82
R5062:Pak1ip1 UTSW 13 41008145 splice site probably benign
R5929:Pak1ip1 UTSW 13 41004800 missense probably benign 0.42
R6101:Pak1ip1 UTSW 13 41004885 missense probably damaging 1.00
R6105:Pak1ip1 UTSW 13 41004885 missense probably damaging 1.00
R6198:Pak1ip1 UTSW 13 41001410 missense probably benign
R7179:Pak1ip1 UTSW 13 41009542 missense probably damaging 0.97
R7367:Pak1ip1 UTSW 13 41008895 missense probably damaging 1.00
R7487:Pak1ip1 UTSW 13 41009255 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCCTTATTTCCTAGATGGCAGAAG -3'
(R):5'- ATCCAGTCAAGCCTGCACTG -3'

Sequencing Primer
(F):5'- TTCCTAGATGGCAGAAGATAACCTG -3'
(R):5'- ACTGCAGTGTGTTGACAG -3'
Posted On2015-06-20