Incidental Mutation 'R4255:Fgfr4'
ID 321796
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Name fibroblast growth factor receptor 4
Synonyms Fgfr-4
MMRRC Submission 041068-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4255 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 55300631-55316572 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 55314064 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 593 (V593M)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: V593M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: V593M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Meta Mutation Damage Score 0.9088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,136,949 (GRCm39) I171V probably benign Het
Actc1 T C 2: 113,879,697 (GRCm39) N254S probably benign Het
Adgrg1 T G 8: 95,732,530 (GRCm39) probably null Het
Ankrd7 T A 6: 18,869,880 (GRCm39) probably null Het
Baz2b T C 2: 59,750,916 (GRCm39) probably benign Het
Brca2 A G 5: 150,464,634 (GRCm39) E1466G possibly damaging Het
Dagla G A 19: 10,234,316 (GRCm39) R332* probably null Het
Dnah5 T A 15: 28,438,248 (GRCm39) S3960T probably benign Het
Dnhd1 T A 7: 105,362,205 (GRCm39) L3689M probably damaging Het
Epn1 T A 7: 5,100,637 (GRCm39) L530Q probably damaging Het
Fgf17 C A 14: 70,879,162 (GRCm39) probably null Het
Fmo4 A G 1: 162,621,895 (GRCm39) C439R probably benign Het
Fndc3b T C 3: 27,555,556 (GRCm39) K333E possibly damaging Het
Gpc6 A G 14: 118,188,553 (GRCm39) T396A probably benign Het
Igkv3-2 T A 6: 70,676,045 (GRCm39) V118D probably benign Het
Mtbp C A 15: 55,484,081 (GRCm39) S470R possibly damaging Het
Myh8 A G 11: 67,190,560 (GRCm39) D1295G probably benign Het
Myo1h T C 5: 114,468,198 (GRCm39) I331T possibly damaging Het
Myo7a T G 7: 97,721,171 (GRCm39) M1265L probably damaging Het
Or13a18 C A 7: 140,190,500 (GRCm39) Y132* probably null Het
Or2ak7 A T 11: 58,574,791 (GRCm39) I31F probably damaging Het
Or2o1 G A 11: 49,051,262 (GRCm39) W140* probably null Het
Pak1ip1 A G 13: 41,164,632 (GRCm39) probably benign Het
Pcdha11 A G 18: 37,145,843 (GRCm39) T645A probably benign Het
Peg12 A G 7: 62,113,479 (GRCm39) I206T possibly damaging Het
Pkhd1 A G 1: 20,664,158 (GRCm39) V140A probably damaging Het
Pramel29 T A 4: 143,934,054 (GRCm39) D351V possibly damaging Het
Prrc2c C A 1: 162,533,895 (GRCm39) probably benign Het
Ptprk A G 10: 28,082,241 (GRCm39) E70G probably benign Het
Rabl6 C T 2: 25,474,791 (GRCm39) E640K possibly damaging Het
Rasd2 G A 8: 75,948,538 (GRCm39) E155K probably damaging Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Sdf4 A G 4: 156,085,214 (GRCm39) H183R probably benign Het
Slc12a9 C T 5: 137,319,694 (GRCm39) R607H probably damaging Het
Slc38a1 T C 15: 96,483,431 (GRCm39) D299G probably benign Het
Slc4a10 A G 2: 62,112,280 (GRCm39) N657S probably benign Het
Spata31d1c C G 13: 65,183,502 (GRCm39) S348* probably null Het
Spata31d1c T C 13: 65,183,531 (GRCm39) F358L probably benign Het
Srbd1 A T 17: 86,410,350 (GRCm39) S527R possibly damaging Het
Stag3 T C 5: 138,289,143 (GRCm39) V243A probably damaging Het
Tefm A T 11: 80,031,075 (GRCm39) S54T probably damaging Het
Terf1 T C 1: 15,875,903 (GRCm39) M1T probably null Het
Thsd7b G A 1: 129,688,024 (GRCm39) S645N possibly damaging Het
Trmt13 G T 3: 116,376,337 (GRCm39) S285* probably null Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ush2a C T 1: 188,492,040 (GRCm39) R3110* probably null Het
Vnn3 T C 10: 23,741,720 (GRCm39) Y342H probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55,306,983 (GRCm39) missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55,308,992 (GRCm39) missense probably benign
IGL02817:Fgfr4 APN 13 55,304,481 (GRCm39) critical splice donor site probably null
interference UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
Modest UTSW 13 55,314,064 (GRCm39) missense probably damaging 1.00
offense UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R0153:Fgfr4 UTSW 13 55,309,198 (GRCm39) splice site probably benign
R0727:Fgfr4 UTSW 13 55,304,041 (GRCm39) splice site probably null
R1646:Fgfr4 UTSW 13 55,313,777 (GRCm39) missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55,315,605 (GRCm39) splice site probably null
R1993:Fgfr4 UTSW 13 55,313,715 (GRCm39) missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55,315,702 (GRCm39) missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55,314,777 (GRCm39) missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55,315,714 (GRCm39) missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55,315,205 (GRCm39) splice site probably benign
R3939:Fgfr4 UTSW 13 55,304,307 (GRCm39) missense probably null 0.96
R4463:Fgfr4 UTSW 13 55,304,280 (GRCm39) missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55,309,328 (GRCm39) missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55,315,983 (GRCm39) missense unknown
R5133:Fgfr4 UTSW 13 55,307,828 (GRCm39) missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55,313,725 (GRCm39) missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55,315,230 (GRCm39) missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55,304,464 (GRCm39) missense probably benign
R5927:Fgfr4 UTSW 13 55,314,700 (GRCm39) missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55,313,921 (GRCm39) missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55,304,711 (GRCm39) missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55,314,013 (GRCm39) missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55,309,262 (GRCm39) missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55,306,968 (GRCm39) missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55,308,969 (GRCm39) missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55,306,964 (GRCm39) missense probably benign 0.22
R9028:Fgfr4 UTSW 13 55,306,967 (GRCm39) missense probably damaging 1.00
R9144:Fgfr4 UTSW 13 55,315,837 (GRCm39) critical splice acceptor site probably null
R9257:Fgfr4 UTSW 13 55,315,974 (GRCm39) missense unknown
R9399:Fgfr4 UTSW 13 55,304,293 (GRCm39) missense probably damaging 1.00
R9457:Fgfr4 UTSW 13 55,308,940 (GRCm39) missense probably benign
R9553:Fgfr4 UTSW 13 55,309,228 (GRCm39) missense probably damaging 0.99
R9620:Fgfr4 UTSW 13 55,308,994 (GRCm39) missense possibly damaging 0.68
Z1177:Fgfr4 UTSW 13 55,313,742 (GRCm39) missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55,309,520 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCAGATGCGCAGTTGGG -3'
(R):5'- CAGGGTTAGCTGCAAATGTATGG -3'

Sequencing Primer
(F):5'- GGATGCAAAGGACCACTCTTGC -3'
(R):5'- TTAGCTGCAAATGTATGGGAATG -3'
Posted On 2015-06-20