Incidental Mutation 'R4255:Fgfr4'
ID321796
Institutional Source Beutler Lab
Gene Symbol Fgfr4
Ensembl Gene ENSMUSG00000005320
Gene Namefibroblast growth factor receptor 4
SynonymsFgfr-4
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55152640-55168759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55166251 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 593 (V593M)
Ref Sequence ENSEMBL: ENSMUSP00000005452 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005452]
Predicted Effect probably damaging
Transcript: ENSMUST00000005452
AA Change: V593M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000005452
Gene: ENSMUSG00000005320
AA Change: V593M

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IGc2 45 105 1.39e-11 SMART
IGc2 160 228 3.1e-18 SMART
IGc2 259 337 1.59e-6 SMART
low complexity region 369 387 N/A INTRINSIC
low complexity region 416 446 N/A INTRINSIC
TyrKc 464 740 1.67e-148 SMART
low complexity region 764 795 N/A INTRINSIC
Meta Mutation Damage Score 0.9088 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. The genomic organization of this gene, compared to members 1-3, encompasses 18 exons rather than 19 or 20. Although alternative splicing has been observed, there is no evidence that the C-terminal half of the IgIII domain of this protein varies between three alternate forms, as indicated for members 1-3. This particular family member preferentially binds acidic fibroblast growth factor and, although its specific function is unknown, it is overexpressed in gynecological tumor samples, suggesting a role in breast and ovarian tumorigenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted mutation are viable, healthy and overtly normal, except for a 10% weight reduction at weaning. Mice doubly homozygous for disruptions of Fgfr3 and Fgfr4 show novel phenotypes not seen in either single mutant, including dwarfismand defective respiratory alveogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Fgfr4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00848:Fgfr4 APN 13 55159170 missense probably damaging 0.99
IGL02140:Fgfr4 APN 13 55161179 missense probably benign
IGL02817:Fgfr4 APN 13 55156668 critical splice donor site probably null
Modest UTSW 13 55166251 missense probably damaging 1.00
R0153:Fgfr4 UTSW 13 55161385 splice site probably benign
R0727:Fgfr4 UTSW 13 55156228 splice site probably null
R1646:Fgfr4 UTSW 13 55165964 missense probably damaging 1.00
R1749:Fgfr4 UTSW 13 55167792 splice site probably null
R1993:Fgfr4 UTSW 13 55165902 missense probably damaging 1.00
R2037:Fgfr4 UTSW 13 55167889 missense possibly damaging 0.51
R2152:Fgfr4 UTSW 13 55166964 missense probably damaging 1.00
R2386:Fgfr4 UTSW 13 55167901 missense probably benign 0.36
R3086:Fgfr4 UTSW 13 55167392 splice site probably benign
R3939:Fgfr4 UTSW 13 55156494 missense probably null 0.96
R4463:Fgfr4 UTSW 13 55156467 missense probably benign 0.02
R4510:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4511:Fgfr4 UTSW 13 55161515 missense possibly damaging 0.81
R4852:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R4932:Fgfr4 UTSW 13 55168170 missense unknown
R5133:Fgfr4 UTSW 13 55160015 missense probably damaging 1.00
R5146:Fgfr4 UTSW 13 55165912 missense probably damaging 1.00
R5380:Fgfr4 UTSW 13 55167417 missense probably damaging 1.00
R5431:Fgfr4 UTSW 13 55156651 missense probably benign
R5927:Fgfr4 UTSW 13 55166887 missense probably damaging 1.00
R6318:Fgfr4 UTSW 13 55166108 missense probably damaging 1.00
R6792:Fgfr4 UTSW 13 55156898 missense possibly damaging 0.65
R7018:Fgfr4 UTSW 13 55166200 missense probably damaging 0.98
R7290:Fgfr4 UTSW 13 55161449 missense probably benign 0.00
R7343:Fgfr4 UTSW 13 55159155 missense probably damaging 1.00
R7808:Fgfr4 UTSW 13 55161156 missense possibly damaging 0.68
R7891:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
R7974:Fgfr4 UTSW 13 55159151 missense probably benign 0.22
Z1177:Fgfr4 UTSW 13 55161707 missense probably damaging 1.00
Z1177:Fgfr4 UTSW 13 55165929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCAGATGCGCAGTTGGG -3'
(R):5'- CAGGGTTAGCTGCAAATGTATGG -3'

Sequencing Primer
(F):5'- GGATGCAAAGGACCACTCTTGC -3'
(R):5'- TTAGCTGCAAATGTATGGGAATG -3'
Posted On2015-06-20