Incidental Mutation 'R4255:Spata31d1c'
ID321797
Institutional Source Beutler Lab
Gene Symbol Spata31d1c
Ensembl Gene ENSMUSG00000074849
Gene Namespermatogenesis associated 31 subfamily D, member 1C
Synonyms4932441B19Rik, Fam75d1c
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65033058-65038004 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 65035688 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 348 (S348*)
Ref Sequence ENSEMBL: ENSMUSP00000097024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099427]
Predicted Effect probably null
Transcript: ENSMUST00000099427
AA Change: S348*
SMART Domains Protein: ENSMUSP00000097024
Gene: ENSMUSG00000074849
AA Change: S348*

DomainStartEndE-ValueType
transmembrane domain 22 44 N/A INTRINSIC
Pfam:DUF4599 63 148 2.4e-31 PFAM
low complexity region 178 190 N/A INTRINSIC
low complexity region 196 213 N/A INTRINSIC
low complexity region 218 233 N/A INTRINSIC
low complexity region 237 251 N/A INTRINSIC
Pfam:FAM75 380 742 1.4e-120 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Gpc6 A G 14: 117,951,141 T396A probably benign Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Spata31d1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01639:Spata31d1c APN 13 65036089 missense probably damaging 1.00
IGL02830:Spata31d1c APN 13 65035366 missense probably benign 0.25
IGL02947:Spata31d1c APN 13 65034945 nonsense probably null
IGL03133:Spata31d1c APN 13 65034985 missense probably benign 0.18
IGL03176:Spata31d1c APN 13 65037011 missense probably benign 0.01
IGL03183:Spata31d1c APN 13 65035195 missense possibly damaging 0.86
IGL03206:Spata31d1c APN 13 65035593 missense probably benign 0.41
PIT4382001:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R0054:Spata31d1c UTSW 13 65033062 start gained probably benign
R0959:Spata31d1c UTSW 13 65036315 missense probably damaging 1.00
R1232:Spata31d1c UTSW 13 65036614 missense probably benign
R1347:Spata31d1c UTSW 13 65035388 missense probably benign 0.00
R1381:Spata31d1c UTSW 13 65036554 missense probably benign 0.08
R1573:Spata31d1c UTSW 13 65035069 missense possibly damaging 0.92
R1582:Spata31d1c UTSW 13 65033224 missense probably benign
R1639:Spata31d1c UTSW 13 65036039 missense probably benign
R1716:Spata31d1c UTSW 13 65033216 missense possibly damaging 0.86
R1781:Spata31d1c UTSW 13 65036171 missense probably benign 0.01
R1907:Spata31d1c UTSW 13 65035876 missense probably benign 0.03
R2012:Spata31d1c UTSW 13 65035227 missense possibly damaging 0.91
R2152:Spata31d1c UTSW 13 65033965 critical splice donor site probably null
R2211:Spata31d1c UTSW 13 65035939 missense probably benign 0.04
R2571:Spata31d1c UTSW 13 65036384 missense probably damaging 1.00
R2908:Spata31d1c UTSW 13 65033191 missense possibly damaging 0.63
R3978:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3979:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3980:Spata31d1c UTSW 13 65035160 missense possibly damaging 0.61
R3981:Spata31d1c UTSW 13 65035111 missense possibly damaging 0.68
R4014:Spata31d1c UTSW 13 65035399 missense probably damaging 0.99
R4255:Spata31d1c UTSW 13 65035717 missense probably benign 0.04
R4592:Spata31d1c UTSW 13 65036060 missense probably damaging 0.99
R4597:Spata31d1c UTSW 13 65035613 nonsense probably null
R4624:Spata31d1c UTSW 13 65036597 missense probably benign
R4641:Spata31d1c UTSW 13 65035048 missense probably benign 0.01
R4863:Spata31d1c UTSW 13 65035790 nonsense probably null
R5084:Spata31d1c UTSW 13 65035130 missense probably damaging 0.98
R5152:Spata31d1c UTSW 13 65035595 missense probably damaging 1.00
R5230:Spata31d1c UTSW 13 65035434 missense probably benign 0.41
R5267:Spata31d1c UTSW 13 65035904 missense probably damaging 0.98
R5615:Spata31d1c UTSW 13 65035264 missense possibly damaging 0.61
R5755:Spata31d1c UTSW 13 65036527 missense probably benign 0.12
R5935:Spata31d1c UTSW 13 65037080 missense possibly damaging 0.68
R6017:Spata31d1c UTSW 13 65035079 missense possibly damaging 0.91
R6131:Spata31d1c UTSW 13 65035671 missense probably benign 0.10
R6359:Spata31d1c UTSW 13 65035592 missense possibly damaging 0.63
R6723:Spata31d1c UTSW 13 65035944 missense probably benign 0.01
R7028:Spata31d1c UTSW 13 65036063 missense probably damaging 0.98
R7336:Spata31d1c UTSW 13 65036128 missense probably damaging 0.99
R7426:Spata31d1c UTSW 13 65035361 missense probably benign
R7552:Spata31d1c UTSW 13 65036123 missense probably damaging 0.98
R7605:Spata31d1c UTSW 13 65035840 missense probably benign 0.00
R7666:Spata31d1c UTSW 13 65036000 missense probably benign 0.01
R8403:Spata31d1c UTSW 13 65036230 missense probably benign 0.42
R8445:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8513:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8515:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8523:Spata31d1c UTSW 13 65033177 missense probably damaging 0.98
R8799:Spata31d1c UTSW 13 65036326 missense possibly damaging 0.92
R8817:Spata31d1c UTSW 13 65034562 missense probably damaging 0.98
R8854:Spata31d1c UTSW 13 65035990 missense possibly damaging 0.82
X0022:Spata31d1c UTSW 13 65036927 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCTTCCCAGTTGGAGTCAGC -3'
(R):5'- GGGAACTGTCAGTCAACACAGTAG -3'

Sequencing Primer
(F):5'- GTTGGAGTCAGCACATCCAGTTAAC -3'
(R):5'- GCAATAGAGTTCATGGACTCACTGTG -3'
Posted On2015-06-20