Incidental Mutation 'R4255:Gpc6'
ID321800
Institutional Source Beutler Lab
Gene Symbol Gpc6
Ensembl Gene ENSMUSG00000058571
Gene Nameglypican 6
Synonyms6720429C22Rik
MMRRC Submission 041068-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R4255 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location116925315-117976544 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117951141 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 396 (T396A)
Ref Sequence ENSEMBL: ENSMUSP00000120362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078849] [ENSMUST00000088483] [ENSMUST00000125435]
Predicted Effect probably benign
Transcript: ENSMUST00000078849
AA Change: T386A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000077893
Gene: ENSMUSG00000058571
AA Change: T386A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088483
AA Change: T386A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000085835
Gene: ENSMUSG00000058571
AA Change: T386A

DomainStartEndE-ValueType
Pfam:Glypican 7 554 9.3e-247 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125435
AA Change: T396A

PolyPhen 2 Score 0.152 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000120362
Gene: ENSMUSG00000058571
AA Change: T396A

DomainStartEndE-ValueType
Pfam:Glypican 15 564 7.2e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183564
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 93% (50/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The glypicans comprise a family of glycosylphosphatidylinositol-anchored heparan sulfate proteoglycans, and they have been implicated in the control of cell growth and cell division. The glypican encoded by this gene is a putative cell surface coreceptor for growth factors, extracellular matrix proteins, proteases and anti-proteases. Mutations in this gene are associated with omodysplasia 1. [provided by RefSeq, Nov 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality, decreased fetal weight, short long bones, small skull, small snout, cleft palate and decreased chondrocyte proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,306,605 I171V probably benign Het
Actc1 T C 2: 114,049,216 N254S probably benign Het
Adgrg1 T G 8: 95,005,902 probably null Het
Ankrd7 T A 6: 18,869,881 probably null Het
Baz2b T C 2: 59,920,572 probably benign Het
Brca2 A G 5: 150,541,169 E1466G possibly damaging Het
C87977 T A 4: 144,207,484 D351V possibly damaging Het
Dagla G A 19: 10,256,952 R332* probably null Het
Dnah5 T A 15: 28,438,102 S3960T probably benign Het
Dnhd1 T A 7: 105,712,998 L3689M probably damaging Het
Epn1 T A 7: 5,097,638 L530Q probably damaging Het
Fgf17 C A 14: 70,641,722 probably null Het
Fgfr4 G A 13: 55,166,251 V593M probably damaging Het
Fmo4 A G 1: 162,794,326 C439R probably benign Het
Fndc3b T C 3: 27,501,407 K333E possibly damaging Het
Igkv3-2 T A 6: 70,699,061 V118D probably benign Het
Mtbp C A 15: 55,620,685 S470R possibly damaging Het
Myh8 A G 11: 67,299,734 D1295G probably benign Het
Myo1h T C 5: 114,330,137 I331T possibly damaging Het
Myo7a T G 7: 98,071,964 M1265L probably damaging Het
Olfr1394 G A 11: 49,160,435 W140* probably null Het
Olfr320 A T 11: 58,683,965 I31F probably damaging Het
Olfr46 C A 7: 140,610,587 Y132* probably null Het
Pak1ip1 A G 13: 41,011,156 probably benign Het
Pcdha11 A G 18: 37,012,790 T645A probably benign Het
Peg12 A G 7: 62,463,731 I206T possibly damaging Het
Pkhd1 A G 1: 20,593,934 V140A probably damaging Het
Prrc2c C A 1: 162,706,326 probably benign Het
Ptprk A G 10: 28,206,245 E70G probably benign Het
Rabl6 C T 2: 25,584,779 E640K possibly damaging Het
Rasd2 G A 8: 75,221,910 E155K probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sdf4 A G 4: 156,000,757 H183R probably benign Het
Slc12a9 C T 5: 137,321,432 R607H probably damaging Het
Slc38a1 T C 15: 96,585,550 D299G probably benign Het
Slc4a10 A G 2: 62,281,936 N657S probably benign Het
Spata31d1c C G 13: 65,035,688 S348* probably null Het
Spata31d1c T C 13: 65,035,717 F358L probably benign Het
Srbd1 A T 17: 86,102,922 S527R possibly damaging Het
Stag3 T C 5: 138,290,881 V243A probably damaging Het
Tefm A T 11: 80,140,249 S54T probably damaging Het
Terf1 T C 1: 15,805,679 M1T probably null Het
Thsd7b G A 1: 129,760,287 S645N possibly damaging Het
Trmt13 G T 3: 116,582,688 S285* probably null Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ush2a C T 1: 188,759,843 R3110* probably null Het
Vnn3 T C 10: 23,865,822 Y342H probably benign Het
Other mutations in Gpc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00597:Gpc6 APN 14 117951234 missense probably benign 0.01
IGL00671:Gpc6 APN 14 117186787 missense probably benign 0.01
IGL00928:Gpc6 APN 14 116925958 missense possibly damaging 0.86
IGL01343:Gpc6 APN 14 117186812 missense possibly damaging 0.54
IGL01545:Gpc6 APN 14 117964830 missense probably damaging 1.00
IGL02797:Gpc6 APN 14 116925982 missense probably damaging 0.98
PIT1430001:Gpc6 UTSW 14 117951182 nonsense probably null
R0577:Gpc6 UTSW 14 117436008 missense probably benign 0.03
R0611:Gpc6 UTSW 14 117975018 missense probably null
R0636:Gpc6 UTSW 14 117624493 missense probably benign 0.37
R2152:Gpc6 UTSW 14 116926092 missense probably benign 0.00
R2242:Gpc6 UTSW 14 117186787 missense probably benign 0.01
R2266:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2267:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R2269:Gpc6 UTSW 14 117888520 critical splice acceptor site probably null
R3788:Gpc6 UTSW 14 117624466 missense probably damaging 0.98
R4276:Gpc6 UTSW 14 117435916 missense probably damaging 0.99
R4411:Gpc6 UTSW 14 117951178 missense probably benign 0.45
R4626:Gpc6 UTSW 14 117964843 nonsense probably null
R4993:Gpc6 UTSW 14 117624539 missense possibly damaging 0.93
R5070:Gpc6 UTSW 14 117186769 missense probably benign 0.01
R6007:Gpc6 UTSW 14 117951261 missense probably damaging 1.00
R6058:Gpc6 UTSW 14 117964770 missense probably damaging 1.00
R6488:Gpc6 UTSW 14 117964713 missense possibly damaging 0.73
R6901:Gpc6 UTSW 14 117951217 missense possibly damaging 0.87
R6981:Gpc6 UTSW 14 117624548 missense probably damaging 0.98
R7200:Gpc6 UTSW 14 117964856 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TTCTCTGGGAGGAGCAAGAG -3'
(R):5'- AGAGTCTTGCAGGGTTGAGC -3'

Sequencing Primer
(F):5'- GGGAAGTGGAGGCAGACAGC -3'
(R):5'- TGCTGTGCCCCATCAGC -3'
Posted On2015-06-20