Incidental Mutation 'R4256:Nbeal1'
ID 321806
Institutional Source Beutler Lab
Gene Symbol Nbeal1
Ensembl Gene ENSMUSG00000073664
Gene Name neurobeachin like 1
Synonyms A530083I02Rik, A530050O19Rik, ALS2CR17, 2310076G13Rik
MMRRC Submission 041069-MU
Accession Numbers

Genbank: NM_173444; MGI: 2444343
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4256 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 60180599-60338328 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 60330948 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 2675 (I2675V)
Ref Sequence ENSEMBL: ENSMUSP00000124056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160834] [ENSMUST00000162291]
AlphaFold E9PYP2
Predicted Effect probably benign
Transcript: ENSMUST00000160834
AA Change: I2675V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000124056
Gene: ENSMUSG00000073664
AA Change: I2675V

DomainStartEndE-ValueType
low complexity region 522 541 N/A INTRINSIC
Pfam:Laminin_G_3 567 801 8.3e-9 PFAM
low complexity region 1383 1401 N/A INTRINSIC
low complexity region 1849 1865 N/A INTRINSIC
Pfam:PH_BEACH 1882 1975 4.9e-32 PFAM
Beach 1998 2278 7.2e-199 SMART
Blast:Beach 2342 2405 6e-30 BLAST
WD40 2425 2463 5.52e-2 SMART
WD40 2475 2514 4.95e-4 SMART
WD40 2604 2649 7.64e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162291
SMART Domains Protein: ENSMUSP00000125592
Gene: ENSMUSG00000073664

DomainStartEndE-ValueType
low complexity region 114 132 N/A INTRINSIC
low complexity region 580 596 N/A INTRINSIC
Pfam:PH_BEACH 613 706 9.6e-33 PFAM
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
Allele List at MGI

All alleles(16) : Targeted(1) Gene trapped(15)
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Nbeal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nbeal1 APN 1 60235191 nonsense probably null 0.00
IGL00334:Nbeal1 APN 1 60281883 missense probably damaging 0.98
IGL00334:Nbeal1 APN 1 60328103 missense probably damaging 1.00
IGL00514:Nbeal1 APN 1 60217225 missense probably benign 0.31
IGL00596:Nbeal1 APN 1 60181741 missense probably damaging 0.96
IGL00654:Nbeal1 APN 1 60195011 critical splice acceptor site probably benign 0.00
IGL00757:Nbeal1 APN 1 60195143 missense possibly damaging 0.82
IGL00771:Nbeal1 APN 1 60235353 missense probably benign 0.11
IGL01315:Nbeal1 APN 1 60281341 missense probably damaging 1.00
IGL01445:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01456:Nbeal1 APN 1 60230628 missense probably damaging 1.00
IGL01458:Nbeal1 APN 1 60242625 critical splice donor site probably null
IGL01535:Nbeal1 APN 1 60217255 missense probably damaging 1.00
IGL01608:Nbeal1 APN 1 60242535 critical splice acceptor site probably benign 0.00
IGL02006:Nbeal1 APN 1 60272259 critical splice donor site probably null
IGL02105:Nbeal1 APN 1 60253501 missense probably damaging 1.00
IGL02409:Nbeal1 APN 1 60329335 missense probably benign 0.01
IGL02713:Nbeal1 APN 1 60235237 missense possibly damaging 0.94
IGL02720:Nbeal1 APN 1 60283987 missense probably damaging 0.98
IGL02887:Nbeal1 APN 1 60287444 splice site probably benign
IGL02945:Nbeal1 APN 1 60206410 missense probably damaging 1.00
IGL03023:Nbeal1 APN 1 60253413 missense probably damaging 0.98
IGL03114:Nbeal1 APN 1 60278727 missense probably damaging 1.00
IGL03231:Nbeal1 APN 1 60236459 missense probably benign 0.44
IGL03241:Nbeal1 APN 1 60234868 missense possibly damaging 0.46
IGL03241:Nbeal1 APN 1 60234869 missense probably benign 0.44
IGL03382:Nbeal1 APN 1 60261586 critical splice donor site probably null
IGL03412:Nbeal1 APN 1 60242567 nonsense probably null
coach UTSW 1 60253481 nonsense probably null
Committee UTSW 1 60292903 missense probably damaging 1.00
Disgrace UTSW 1 60281310 nonsense probably null
Dravrah UTSW 1 60284092 missense probably damaging 1.00
Harvard UTSW 1 60235563 splice site probably null
horrified UTSW 1 60244824 missense probably damaging 1.00
Lampoon UTSW 1 60261586 critical splice donor site probably null
lawyer UTSW 1 60310224 nonsense probably null
magistrate UTSW 1 60194597 critical splice donor site probably null
Maratimus UTSW 1 60291888 missense probably damaging 1.00
National UTSW 1 60222263 missense possibly damaging 0.95
phainopepla UTSW 1 60319687 missense probably damaging 1.00
R3875_Nbeal1_770 UTSW 1 60194599 splice site probably benign
satirical UTSW 1 60235562 critical splice donor site probably null
silky UTSW 1 60330878 splice site probably benign
stiggs UTSW 1 60237151 missense probably benign 0.11
3-1:Nbeal1 UTSW 1 60264272 splice site probably benign
P0007:Nbeal1 UTSW 1 60319688 missense probably damaging 0.98
P0028:Nbeal1 UTSW 1 60291937 missense probably damaging 1.00
R0041:Nbeal1 UTSW 1 60281871 missense probably benign 0.05
R0051:Nbeal1 UTSW 1 60310263 missense probably benign 0.19
R0052:Nbeal1 UTSW 1 60228612 splice site probably benign
R0054:Nbeal1 UTSW 1 60287401 utr 3 prime probably benign
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0062:Nbeal1 UTSW 1 60247717 missense probably benign 0.01
R0094:Nbeal1 UTSW 1 60305309 missense possibly damaging 0.62
R0310:Nbeal1 UTSW 1 60305370 splice site probably benign
R0324:Nbeal1 UTSW 1 60292873 missense probably damaging 1.00
R0329:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0330:Nbeal1 UTSW 1 60268063 missense probably damaging 1.00
R0417:Nbeal1 UTSW 1 60247734 missense probably benign 0.00
R0421:Nbeal1 UTSW 1 60268439 missense probably benign 0.08
R0617:Nbeal1 UTSW 1 60281832 nonsense probably null
R1034:Nbeal1 UTSW 1 60290006 nonsense probably null
R1082:Nbeal1 UTSW 1 60312226 missense probably damaging 0.99
R1123:Nbeal1 UTSW 1 60260269 missense probably benign
R1187:Nbeal1 UTSW 1 60194528 missense probably damaging 1.00
R1484:Nbeal1 UTSW 1 60200939 missense probably damaging 1.00
R1594:Nbeal1 UTSW 1 60305291 missense possibly damaging 0.91
R1651:Nbeal1 UTSW 1 60200119 missense probably damaging 1.00
R1678:Nbeal1 UTSW 1 60260334 missense probably benign 0.00
R1806:Nbeal1 UTSW 1 60284092 missense probably damaging 1.00
R1937:Nbeal1 UTSW 1 60267941 nonsense probably null
R1952:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R1953:Nbeal1 UTSW 1 60234840 missense probably damaging 1.00
R2038:Nbeal1 UTSW 1 60206344 missense probably benign 0.00
R2044:Nbeal1 UTSW 1 60319687 missense probably damaging 1.00
R2050:Nbeal1 UTSW 1 60292964 splice site probably null
R2055:Nbeal1 UTSW 1 60311057 missense probably damaging 1.00
R2064:Nbeal1 UTSW 1 60270356 missense possibly damaging 0.89
R2100:Nbeal1 UTSW 1 60305271 splice site probably null
R2181:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R2192:Nbeal1 UTSW 1 60281895 missense probably damaging 1.00
R2203:Nbeal1 UTSW 1 60284006 missense probably benign 0.21
R2267:Nbeal1 UTSW 1 60330878 splice site probably benign
R2268:Nbeal1 UTSW 1 60330878 splice site probably benign
R2351:Nbeal1 UTSW 1 60237098 missense possibly damaging 0.90
R2366:Nbeal1 UTSW 1 60251352 missense probably damaging 0.97
R2393:Nbeal1 UTSW 1 60251370 missense probably damaging 0.98
R3545:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3546:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3547:Nbeal1 UTSW 1 60278780 missense probably damaging 1.00
R3701:Nbeal1 UTSW 1 60251413 splice site probably benign
R3747:Nbeal1 UTSW 1 60195023 missense probably damaging 0.98
R3875:Nbeal1 UTSW 1 60194599 splice site probably benign
R4119:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R4371:Nbeal1 UTSW 1 60289946 missense possibly damaging 0.95
R4450:Nbeal1 UTSW 1 60267774 missense probably damaging 0.97
R4558:Nbeal1 UTSW 1 60281310 nonsense probably null
R4618:Nbeal1 UTSW 1 60228731 intron probably benign
R4673:Nbeal1 UTSW 1 60329390 missense probably damaging 1.00
R4719:Nbeal1 UTSW 1 60235563 splice site probably null
R4798:Nbeal1 UTSW 1 60222193 splice site probably null
R4826:Nbeal1 UTSW 1 60251342 missense possibly damaging 0.79
R4841:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4842:Nbeal1 UTSW 1 60253375 missense probably damaging 1.00
R4895:Nbeal1 UTSW 1 60292903 missense probably damaging 1.00
R4929:Nbeal1 UTSW 1 60238654 missense probably damaging 1.00
R5026:Nbeal1 UTSW 1 60237179 missense probably damaging 1.00
R5243:Nbeal1 UTSW 1 60270328 missense probably damaging 0.99
R5300:Nbeal1 UTSW 1 60235559 nonsense probably null
R5345:Nbeal1 UTSW 1 60328210 critical splice donor site probably null
R5502:Nbeal1 UTSW 1 60310999 missense probably damaging 1.00
R5542:Nbeal1 UTSW 1 60277194 missense probably benign 0.00
R5555:Nbeal1 UTSW 1 60237152 missense possibly damaging 0.93
R5580:Nbeal1 UTSW 1 60242602 missense probably benign 0.45
R5765:Nbeal1 UTSW 1 60291847 missense probably damaging 1.00
R5802:Nbeal1 UTSW 1 60272221 missense probably benign 0.01
R5907:Nbeal1 UTSW 1 60228791 intron probably benign
R5918:Nbeal1 UTSW 1 60267892 missense possibly damaging 0.90
R5923:Nbeal1 UTSW 1 60248395 missense probably damaging 1.00
R6066:Nbeal1 UTSW 1 60248405 missense probably benign 0.29
R6091:Nbeal1 UTSW 1 60181556 start gained probably benign
R6113:Nbeal1 UTSW 1 60222263 missense possibly damaging 0.95
R6143:Nbeal1 UTSW 1 60251307 missense possibly damaging 0.81
R6194:Nbeal1 UTSW 1 60257484 missense possibly damaging 0.80
R6197:Nbeal1 UTSW 1 60222128 missense probably damaging 0.99
R6228:Nbeal1 UTSW 1 60295924 missense probably benign 0.00
R6229:Nbeal1 UTSW 1 60248365 missense possibly damaging 0.88
R6309:Nbeal1 UTSW 1 60238719 missense probably benign
R6457:Nbeal1 UTSW 1 60253474 missense probably benign 0.31
R6489:Nbeal1 UTSW 1 60330942 missense possibly damaging 0.89
R6845:Nbeal1 UTSW 1 60281310 nonsense probably null
R7021:Nbeal1 UTSW 1 60261586 critical splice donor site probably null
R7033:Nbeal1 UTSW 1 60310947 missense probably damaging 1.00
R7144:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7145:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7146:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7157:Nbeal1 UTSW 1 60237158 missense probably damaging 1.00
R7157:Nbeal1 UTSW 1 60260634 nonsense probably null
R7209:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7210:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7211:Nbeal1 UTSW 1 60200951 missense probably damaging 1.00
R7212:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7213:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7214:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7283:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7285:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7287:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7296:Nbeal1 UTSW 1 60310224 nonsense probably null
R7312:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7313:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7329:Nbeal1 UTSW 1 60217196 missense probably benign 0.39
R7380:Nbeal1 UTSW 1 60244810 missense probably damaging 1.00
R7414:Nbeal1 UTSW 1 60194597 critical splice donor site probably null
R7477:Nbeal1 UTSW 1 60261584 missense probably benign
R7507:Nbeal1 UTSW 1 60235467 missense probably damaging 1.00
R7642:Nbeal1 UTSW 1 60277227 missense probably benign 0.31
R7678:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7689:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7728:Nbeal1 UTSW 1 60244824 missense probably damaging 1.00
R7757:Nbeal1 UTSW 1 60257450 missense probably damaging 0.97
R7761:Nbeal1 UTSW 1 60319341 missense probably benign 0.00
R7813:Nbeal1 UTSW 1 60291889 missense probably damaging 1.00
R7829:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R7891:Nbeal1 UTSW 1 60260432 missense probably benign
R7902:Nbeal1 UTSW 1 60291870 missense probably damaging 0.99
R8022:Nbeal1 UTSW 1 60260272 nonsense probably null
R8053:Nbeal1 UTSW 1 60279795 missense probably damaging 0.98
R8169:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8170:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8178:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8182:Nbeal1 UTSW 1 60200133 missense probably benign 0.00
R8186:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8187:Nbeal1 UTSW 1 60237151 missense probably benign 0.11
R8193:Nbeal1 UTSW 1 60253481 nonsense probably null
R8209:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
R8226:Nbeal1 UTSW 1 60277177 missense probably damaging 0.99
R8549:Nbeal1 UTSW 1 60235562 critical splice donor site probably null
R8560:Nbeal1 UTSW 1 60235157 missense probably benign 0.38
R8753:Nbeal1 UTSW 1 60268383 missense probably damaging 1.00
R8769:Nbeal1 UTSW 1 60235211 missense probably damaging 0.99
R8771:Nbeal1 UTSW 1 60261584 missense probably benign
R8952:Nbeal1 UTSW 1 60260300 missense probably benign 0.01
R9014:Nbeal1 UTSW 1 60289959 missense probably damaging 1.00
R9056:Nbeal1 UTSW 1 60278726 missense probably damaging 1.00
R9091:Nbeal1 UTSW 1 60268389 missense possibly damaging 0.50
R9138:Nbeal1 UTSW 1 60247745 nonsense probably null
R9168:Nbeal1 UTSW 1 60291888 missense probably damaging 1.00
R9200:Nbeal1 UTSW 1 60281266 missense probably damaging 1.00
R9205:Nbeal1 UTSW 1 60278680 missense probably damaging 1.00
R9270:Nbeal1 UTSW 1 60268389 missense possibly damaging 0.50
R9322:Nbeal1 UTSW 1 60258659 missense possibly damaging 0.91
R9405:Nbeal1 UTSW 1 60310265 missense probably damaging 1.00
R9554:Nbeal1 UTSW 1 60251128 nonsense probably null
R9557:Nbeal1 UTSW 1 60235350 missense probably benign
R9560:Nbeal1 UTSW 1 60329385 missense probably damaging 1.00
R9641:Nbeal1 UTSW 1 60311088 missense probably damaging 1.00
R9784:Nbeal1 UTSW 1 60260582 nonsense probably null
X0022:Nbeal1 UTSW 1 60277232 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCTTGAGTCTAATCTCTAGTACTG -3'
(R):5'- TCCAATATCAAAGCATGGAAGTCC -3'

Sequencing Primer
(F):5'- TCTCTAGTACTGCAATGAGTAGC -3'
(R):5'- GGAAGTCCATTCTTCAGGATAAAACC -3'
Posted On 2015-06-20