Incidental Mutation 'R4256:5730559C18Rik'
ID321807
Institutional Source Beutler Lab
Gene Symbol 5730559C18Rik
Ensembl Gene ENSMUSG00000041605
Gene NameRIKEN cDNA 5730559C18 gene
Synonyms
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4256 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136213531-136234264 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136214350 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 670 (N670K)
Ref Sequence ENSEMBL: ENSMUSP00000113785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120339] [ENSMUST00000168561] [ENSMUST00000212798]
Predicted Effect probably benign
Transcript: ENSMUST00000120339
AA Change: N670K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113785
Gene: ENSMUSG00000041605
AA Change: N670K

DomainStartEndE-ValueType
low complexity region 25 65 N/A INTRINSIC
Pfam:DUF3338 101 230 6.2e-57 PFAM
low complexity region 273 316 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
low complexity region 466 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
SMART Domains Protein: ENSMUSP00000130772
Gene: ENSMUSG00000087230

DomainStartEndE-ValueType
SCOP:d1gw5a_ 126 669 2e-7 SMART
low complexity region 677 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180496
Predicted Effect probably benign
Transcript: ENSMUST00000212798
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in 5730559C18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:5730559C18Rik APN 1 136219775 missense probably damaging 1.00
IGL02466:5730559C18Rik APN 1 136216435 splice site probably null
IGL03408:5730559C18Rik APN 1 136214405 missense probably benign
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0053:5730559C18Rik UTSW 1 136227550 missense probably benign 0.01
R0632:5730559C18Rik UTSW 1 136227618 missense probably benign 0.06
R1218:5730559C18Rik UTSW 1 136214402 missense probably damaging 1.00
R1611:5730559C18Rik UTSW 1 136216117 missense probably damaging 1.00
R3618:5730559C18Rik UTSW 1 136214372 missense probably benign 0.11
R4348:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4350:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R4353:5730559C18Rik UTSW 1 136226208 missense probably damaging 1.00
R5343:5730559C18Rik UTSW 1 136225442 missense probably benign 0.01
R6296:5730559C18Rik UTSW 1 136221071 critical splice donor site probably null
R6597:5730559C18Rik UTSW 1 136226189 missense probably damaging 1.00
R6983:5730559C18Rik UTSW 1 136220156 missense possibly damaging 0.59
R7060:5730559C18Rik UTSW 1 136220197 missense possibly damaging 0.75
R7503:5730559C18Rik UTSW 1 136215937 missense possibly damaging 0.76
R7527:5730559C18Rik UTSW 1 136214384 missense possibly damaging 0.67
R7602:5730559C18Rik UTSW 1 136225397 nonsense probably null
R7675:5730559C18Rik UTSW 1 136216003 missense probably benign 0.04
R7756:5730559C18Rik UTSW 1 136216433 missense probably benign 0.01
R7912:5730559C18Rik UTSW 1 136227541 missense probably benign 0.03
R8261:5730559C18Rik UTSW 1 136225477 missense probably damaging 1.00
X0017:5730559C18Rik UTSW 1 136220182 missense probably damaging 1.00
Z1176:5730559C18Rik UTSW 1 136219783 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- AAATCCTCAGGTCAGGACTTCTG -3'
(R):5'- AGCACCAGGGCTTCACTATC -3'

Sequencing Primer
(F):5'- CTCAGGTCAGGACTTCTGGGAAAC -3'
(R):5'- ACCAGGGCTTCACTATCGATGATG -3'
Posted On2015-06-20