Incidental Mutation 'R4256:Olfr1272'
ID 321808
Institutional Source Beutler Lab
Gene Symbol Olfr1272
Ensembl Gene ENSMUSG00000075061
Gene Name olfactory receptor 1272
Synonyms GA_x6K02T2Q125-51636504-51635578, MOR227-3
MMRRC Submission 041069-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R4256 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 90280263-90292841 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90282062 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 171 (V171E)
Ref Sequence ENSEMBL: ENSMUSP00000150745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099750] [ENSMUST00000117141]
AlphaFold Q8VGN8
Predicted Effect probably damaging
Transcript: ENSMUST00000099750
AA Change: V171E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097339
Gene: ENSMUSG00000075061
AA Change: V171E

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 7.5e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 300 1.5e-5 PFAM
Pfam:7tm_1 39 285 1.8e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117141
AA Change: V171E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Olfr1272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Olfr1272 APN 2 90282081 missense possibly damaging 0.55
IGL01824:Olfr1272 APN 2 90281919 missense probably damaging 1.00
IGL01951:Olfr1272 APN 2 90282007 missense probably damaging 1.00
IGL02473:Olfr1272 APN 2 90281696 missense probably null 1.00
IGL02494:Olfr1272 APN 2 90281951 missense probably benign 0.35
IGL03410:Olfr1272 APN 2 90282213 missense probably damaging 1.00
R0350:Olfr1272 UTSW 2 90282582 splice site probably null
R0363:Olfr1272 UTSW 2 90281856 missense probably damaging 1.00
R0401:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R0666:Olfr1272 UTSW 2 90281868 missense probably damaging 0.96
R1860:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R1861:Olfr1272 UTSW 2 90282158 missense probably damaging 1.00
R2374:Olfr1272 UTSW 2 90282451 missense possibly damaging 0.76
R4737:Olfr1272 UTSW 2 90282381 missense probably damaging 1.00
R4827:Olfr1272 UTSW 2 90282203 missense probably damaging 1.00
R5198:Olfr1272 UTSW 2 90296393 missense probably damaging 1.00
R5589:Olfr1272 UTSW 2 90281969 missense probably damaging 1.00
R6412:Olfr1272 UTSW 2 90281858 missense probably damaging 1.00
R7130:Olfr1272 UTSW 2 90281922 missense probably benign
R7317:Olfr1272 UTSW 2 90282404 missense probably damaging 1.00
R7497:Olfr1272 UTSW 2 90281754 missense possibly damaging 0.74
R7762:Olfr1272 UTSW 2 90296631 nonsense probably null
R8271:Olfr1272 UTSW 2 90282272 missense possibly damaging 0.74
R8347:Olfr1272 UTSW 2 90281676 missense probably benign 0.22
R8703:Olfr1272 UTSW 2 90296493 missense probably damaging 1.00
R8794:Olfr1272 UTSW 2 90281806 nonsense probably null
R8824:Olfr1272 UTSW 2 90296012 missense probably damaging 0.98
R8910:Olfr1272 UTSW 2 90296504 missense possibly damaging 0.80
R8934:Olfr1272 UTSW 2 90282012 missense probably benign 0.07
R9548:Olfr1272 UTSW 2 90281647 makesense probably null
Predicted Primers PCR Primer
(F):5'- TCTGCAGAATGCTTCCTCAAG -3'
(R):5'- GGGCTGTCTGGCTCAGATATTC -3'

Sequencing Primer
(F):5'- CCTCAAGCTGATTAGAATGATAGC -3'
(R):5'- GGTTGCTGAGATTCTCCTGC -3'
Posted On 2015-06-20