Mutagenetix > Incidental Mutations

Incidental Mutation 'R4256:Plekhm1'

321826

Institutional Source

Beutler Lab

Gene Symbol

Plekhm1

Ensembl Gene

ENSMUSG00000034247

Gene Name

pleckstrin homology domain containing, family M (with RUN domain) member 1

Synonyms

B2, D330036J23Rik, AP162

MMRRC Submission

041069-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4256 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

103364275-103412687 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 103370934 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 940 (R940L)

Ref Sequence

ENSEMBL: ENSMUSP00000047327 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041272]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041272
AA Change: R940L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: R940L

Domain	Start	End	E-Value	Type
RUN	117	180	3.36e-20	SMART
low complexity region	246	273	N/A	INTRINSIC
low complexity region	336	350	N/A	INTRINSIC
low complexity region	361	373	N/A	INTRINSIC
Blast:DUF4206	448	543	2e-11	BLAST
PH	552	644	2.16e-9	SMART
low complexity region	658	674	N/A	INTRINSIC
PH	702	797	2.15e-4	SMART
DUF4206	864	1068	7.51e-103	SMART
C1	1005	1058	2.72e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000184350

Meta Mutation Damage Score

0.8392

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.0%

Validation Efficiency

93% (41/44)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930578I06Rik	C	T	14: 63,973,209	R190H	probably benign	Het
5730559C18Rik	G	T	1: 136,214,350	N670K	probably benign	Het
Arsi	T	C	18: 60,917,316	W424R	probably damaging	Het
Atad2	A	G	15: 58,116,856	S411P	probably damaging	Het
Cdhr2	G	A	13: 54,714,005	V72I	probably damaging	Het
Celf4	T	C	18: 25,491,201	I414V	probably damaging	Het
Cfap43	G	A	19: 47,782,405	T689I	probably benign	Het
Cpne9	C	T	6: 113,283,023		probably benign	Het
Cyp3a11	A	T	5: 145,869,195	S121T	probably benign	Het
Dip2c	C	A	13: 9,609,056	Q864K	probably damaging	Het
Fbxo3	A	G	2: 104,051,165	T281A	probably damaging	Het
Gm5148	T	A	3: 37,714,609	H154L	unknown	Het
Gm906	A	C	13: 50,250,105	S54A	probably benign	Het
Gsdma2	T	A	11: 98,651,932		probably null	Het
Hfm1	T	C	5: 106,904,797	I273M	possibly damaging	Het
Hspa4l	A	G	3: 40,746,003	E14G	probably benign	Het
Lgals12	T	G	19: 7,606,716	E5D	possibly damaging	Het
Lsg1	T	G	16: 30,573,243	I237L	probably benign	Het
Mettl14	T	C	3: 123,383,605	E49G	probably damaging	Het
Nbeal1	A	G	1: 60,330,948	I2675V	probably benign	Het
Olfr1272	A	T	2: 90,282,062	V171E	probably damaging	Het
Olfr1391	A	T	11: 49,327,477	Q22L	probably benign	Het
Olfr178	T	G	16: 58,889,780	S147R	probably benign	Het
Padi1	A	T	4: 140,814,778	L611Q	probably damaging	Het
Pcdhac2	A	G	18: 37,144,711	D248G	probably damaging	Het
Rasa3	A	G	8: 13,614,532		probably null	Het
Rspo2	C	A	15: 43,075,911	R161L	probably benign	Het
Sacs	A	G	14: 61,206,337	Y1944C	probably damaging	Het
Slc7a10	G	T	7: 35,198,715	M297I	probably damaging	Het
Ssh2	A	G	11: 77,408,183	T112A	possibly damaging	Het
Ttc7	A	T	17: 87,321,401		probably null	Het
Vmn1r64	T	A	7: 5,883,896	H216L	probably benign	Het
Vmn2r112	A	G	17: 22,618,412	K618R	probably damaging	Het
Vmp1	T	A	11: 86,661,188	I117L	probably benign	Het
Vsnl1	A	T	12: 11,332,055	Y108*	probably null	Het
Wdr31	A	G	4: 62,457,438		probably null	Het
Zfp329	A	G	7: 12,807,913	V284A	probably benign	Het
Zfp551	G	A	7: 12,416,391	H364Y	possibly damaging	Het

Other mutations in Plekhm1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01517:Plekhm1	APN	11	103394783	missense	possibly damaging	0.54
IGL01876:Plekhm1	APN	11	103376751	missense	probably damaging	1.00
IGL02159:Plekhm1	APN	11	103380231	missense	probably benign	0.04
IGL02404:Plekhm1	APN	11	103394998	missense	probably benign	0.18
IGL02537:Plekhm1	APN	11	103397192	missense	probably damaging	1.00
IGL02568:Plekhm1	APN	11	103395050	missense	probably damaging	1.00
IGL02660:Plekhm1	APN	11	103374094	splice site	probably benign
IGL03130:Plekhm1	APN	11	103377381	missense	probably benign	0.17
IGL03208:Plekhm1	APN	11	103376770	missense	probably benign	0.00
R0442:Plekhm1	UTSW	11	103397174	missense	possibly damaging	0.45
R0491:Plekhm1	UTSW	11	103394776	missense	probably benign	0.05
R0520:Plekhm1	UTSW	11	103394944	missense	probably benign	0.17
R0964:Plekhm1	UTSW	11	103395082	nonsense	probably null
R1189:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1501:Plekhm1	UTSW	11	103387062	missense	probably benign	0.00
R1697:Plekhm1	UTSW	11	103376884	missense	probably damaging	1.00
R1781:Plekhm1	UTSW	11	103394856	missense	probably damaging	1.00
R1873:Plekhm1	UTSW	11	103373998	missense	probably benign	0.01
R2087:Plekhm1	UTSW	11	103397025	critical splice donor site	probably null
R2215:Plekhm1	UTSW	11	103376985	missense	probably damaging	1.00
R2271:Plekhm1	UTSW	11	103387122	missense	probably benign	0.00
R4393:Plekhm1	UTSW	11	103376965	missense	possibly damaging	0.51
R4526:Plekhm1	UTSW	11	103395304	missense	probably damaging	0.97
R5119:Plekhm1	UTSW	11	103387315	missense	possibly damaging	0.62
R5975:Plekhm1	UTSW	11	103376691	missense	possibly damaging	0.49
R6389:Plekhm1	UTSW	11	103366894	missense	probably benign	0.21
R6454:Plekhm1	UTSW	11	103377382	missense	probably damaging	1.00
R6755:Plekhm1	UTSW	11	103387243	missense	possibly damaging	0.65
R6830:Plekhm1	UTSW	11	103376889	missense	probably damaging	0.97
R7039:Plekhm1	UTSW	11	103395228	missense	probably damaging	1.00
R7066:Plekhm1	UTSW	11	103370988	missense	possibly damaging	0.47
R7149:Plekhm1	UTSW	11	103394916	missense	probably damaging	0.98
R7349:Plekhm1	UTSW	11	103387334	missense	probably damaging	0.98
R7505:Plekhm1	UTSW	11	103380029	splice site	probably null
R7792:Plekhm1	UTSW	11	103397060	missense	probably damaging	0.99
R7867:Plekhm1	UTSW	11	103380327	missense	probably damaging	1.00
R8124:Plekhm1	UTSW	11	103366949	missense	probably benign	0.02
R8194:Plekhm1	UTSW	11	103395060	missense	possibly damaging	0.68
R8725:Plekhm1	UTSW	11	103367618	missense	probably damaging	1.00
R8727:Plekhm1	UTSW	11	103367618	missense	probably damaging	1.00
R8734:Plekhm1	UTSW	11	103394952	missense	probably damaging	1.00
X0058:Plekhm1	UTSW	11	103377366	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGGATGAAGTGATTTCCCACAG -3'
(R):5'- TGTGAGCTAGCTAACACAACAC -3'

Sequencing Primer
(F):5'- AGTGATTTCCCACAGCCCAGTG -3'
(R):5'- AACACCCAGCCAGAAGTG -3'

Posted On

2015-06-20