Incidental Mutation 'R4256:Plekhm1'
ID321826
Institutional Source Beutler Lab
Gene Symbol Plekhm1
Ensembl Gene ENSMUSG00000034247
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 1
SynonymsB2, D330036J23Rik, AP162
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4256 (G1)
Quality Score99
Status Validated
Chromosome11
Chromosomal Location103364275-103412687 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 103370934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 940 (R940L)
Ref Sequence ENSEMBL: ENSMUSP00000047327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041272]
Predicted Effect probably damaging
Transcript: ENSMUST00000041272
AA Change: R940L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000047327
Gene: ENSMUSG00000034247
AA Change: R940L

DomainStartEndE-ValueType
RUN 117 180 3.36e-20 SMART
low complexity region 246 273 N/A INTRINSIC
low complexity region 336 350 N/A INTRINSIC
low complexity region 361 373 N/A INTRINSIC
Blast:DUF4206 448 543 2e-11 BLAST
PH 552 644 2.16e-9 SMART
low complexity region 658 674 N/A INTRINSIC
PH 702 797 2.15e-4 SMART
DUF4206 864 1068 7.51e-103 SMART
C1 1005 1058 2.72e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184350
Meta Mutation Damage Score 0.8392 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is essential for bone resorption, and may play a critical role in vesicular transport in the osteoclast. Mutations in this gene are associated with autosomal recessive osteopetrosis type 6 (OPTB6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased trabecular bone mass and decreased bone resorption capacity of osteoclasts caused by defects in the peripheral positioning and secretion of lysosomes. Mice homozygous for a gene trap insertion do not exhibit any detectable phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Plekhm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01517:Plekhm1 APN 11 103394783 missense possibly damaging 0.54
IGL01876:Plekhm1 APN 11 103376751 missense probably damaging 1.00
IGL02159:Plekhm1 APN 11 103380231 missense probably benign 0.04
IGL02404:Plekhm1 APN 11 103394998 missense probably benign 0.18
IGL02537:Plekhm1 APN 11 103397192 missense probably damaging 1.00
IGL02568:Plekhm1 APN 11 103395050 missense probably damaging 1.00
IGL02660:Plekhm1 APN 11 103374094 splice site probably benign
IGL03130:Plekhm1 APN 11 103377381 missense probably benign 0.17
IGL03208:Plekhm1 APN 11 103376770 missense probably benign 0.00
R0442:Plekhm1 UTSW 11 103397174 missense possibly damaging 0.45
R0491:Plekhm1 UTSW 11 103394776 missense probably benign 0.05
R0520:Plekhm1 UTSW 11 103394944 missense probably benign 0.17
R0964:Plekhm1 UTSW 11 103395082 nonsense probably null
R1189:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1501:Plekhm1 UTSW 11 103387062 missense probably benign 0.00
R1697:Plekhm1 UTSW 11 103376884 missense probably damaging 1.00
R1781:Plekhm1 UTSW 11 103394856 missense probably damaging 1.00
R1873:Plekhm1 UTSW 11 103373998 missense probably benign 0.01
R2087:Plekhm1 UTSW 11 103397025 critical splice donor site probably null
R2215:Plekhm1 UTSW 11 103376985 missense probably damaging 1.00
R2271:Plekhm1 UTSW 11 103387122 missense probably benign 0.00
R4393:Plekhm1 UTSW 11 103376965 missense possibly damaging 0.51
R4526:Plekhm1 UTSW 11 103395304 missense probably damaging 0.97
R5119:Plekhm1 UTSW 11 103387315 missense possibly damaging 0.62
R5975:Plekhm1 UTSW 11 103376691 missense possibly damaging 0.49
R6389:Plekhm1 UTSW 11 103366894 missense probably benign 0.21
R6454:Plekhm1 UTSW 11 103377382 missense probably damaging 1.00
R6755:Plekhm1 UTSW 11 103387243 missense possibly damaging 0.65
R6830:Plekhm1 UTSW 11 103376889 missense probably damaging 0.97
R7039:Plekhm1 UTSW 11 103395228 missense probably damaging 1.00
R7066:Plekhm1 UTSW 11 103370988 missense possibly damaging 0.47
R7149:Plekhm1 UTSW 11 103394916 missense probably damaging 0.98
R7349:Plekhm1 UTSW 11 103387334 missense probably damaging 0.98
R7505:Plekhm1 UTSW 11 103380029 splice site probably null
R7792:Plekhm1 UTSW 11 103397060 missense probably damaging 0.99
R7867:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
R7950:Plekhm1 UTSW 11 103380327 missense probably damaging 1.00
X0058:Plekhm1 UTSW 11 103377366 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGGATGAAGTGATTTCCCACAG -3'
(R):5'- TGTGAGCTAGCTAACACAACAC -3'

Sequencing Primer
(F):5'- AGTGATTTCCCACAGCCCAGTG -3'
(R):5'- AACACCCAGCCAGAAGTG -3'
Posted On2015-06-20