Incidental Mutation 'R4256:Gm906'
ID321828
Institutional Source Beutler Lab
Gene Symbol Gm906
Ensembl Gene ENSMUSG00000095300
Gene Namepredicted gene 906
SynonymsLOC380882
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R4256 (G1)
Quality Score106
Status Validated
Chromosome13
Chromosomal Location50245181-50250308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 50250105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 54 (S54A)
Ref Sequence ENSEMBL: ENSMUSP00000097121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099521]
Predicted Effect probably benign
Transcript: ENSMUST00000099521
AA Change: S54A

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097121
Gene: ENSMUSG00000095300
AA Change: S54A

DomainStartEndE-ValueType
low complexity region 69 82 N/A INTRINSIC
Pfam:FAM75 96 414 5.3e-15 PFAM
SCOP:d1i5pa1 811 874 1e-2 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Lsg1 T G 16: 30,573,243 I237L probably benign Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Gm906
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00575:Gm906 APN 13 50246716 missense probably damaging 1.00
IGL02008:Gm906 APN 13 50246685 missense probably benign 0.00
R0464:Gm906 UTSW 13 50248275 splice site probably benign
R0481:Gm906 UTSW 13 50246964 missense probably benign 0.33
R0781:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1110:Gm906 UTSW 13 50248260 missense possibly damaging 0.70
R1945:Gm906 UTSW 13 50245491 missense probably damaging 1.00
R3119:Gm906 UTSW 13 50246969 nonsense probably null
R3824:Gm906 UTSW 13 50245512 missense possibly damaging 0.73
R3861:Gm906 UTSW 13 50246851 missense probably benign 0.00
R4607:Gm906 UTSW 13 50245506 missense possibly damaging 0.86
R6126:Gm906 UTSW 13 50246290 missense probably benign 0.18
R6550:Gm906 UTSW 13 50245446 missense probably benign 0.00
R6913:Gm906 UTSW 13 50245257 missense probably damaging 0.99
R6970:Gm906 UTSW 13 50246971 missense possibly damaging 0.86
R7339:Gm906 UTSW 13 50247168 missense possibly damaging 0.86
R7347:Gm906 UTSW 13 50245744 missense probably benign 0.01
R7607:Gm906 UTSW 13 50250260 missense possibly damaging 0.72
R7655:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7656:Gm906 UTSW 13 50247086 missense probably benign 0.00
R7711:Gm906 UTSW 13 50247095 missense probably benign 0.43
R7803:Gm906 UTSW 13 50246190 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGCCCTTCAGAGTCTTTCTAGAGA -3'
(R):5'- GCTGCATTGCGATTCAGAAG -3'

Sequencing Primer
(F):5'- GAGGCAATTCATACTCAGCTGCTG -3'
(R):5'- GCGATTCAGAAGATGGAGAATTTTC -3'
Posted On2015-06-20