Incidental Mutation 'R4256:Lsg1'
ID321835
Institutional Source Beutler Lab
Gene Symbol Lsg1
Ensembl Gene ENSMUSG00000022538
Gene Namelarge 60S subunit nuclear export GTPase 1
SynonymsD16Bwg1547e
MMRRC Submission 041069-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.929) question?
Stock #R4256 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location30560494-30587592 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 30573243 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 237 (I237L)
Ref Sequence ENSEMBL: ENSMUSP00000112860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117363] [ENSMUST00000123286] [ENSMUST00000143170]
Predicted Effect probably benign
Transcript: ENSMUST00000117363
AA Change: I237L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000112860
Gene: ENSMUSG00000022538
AA Change: I237L

DomainStartEndE-ValueType
low complexity region 18 30 N/A INTRINSIC
coiled coil region 129 151 N/A INTRINSIC
SCOP:d1h65a_ 165 280 2e-3 SMART
low complexity region 300 309 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:MMR_HSR1 374 461 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128561
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143170
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231238
Meta Mutation Damage Score 0.0941 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 93% (41/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the yeast large subunit GTPase 1. The encoded protein is necessary for cell viability and may localize in the endoplasmic reticulum, nucleus and cytoplasm.[provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
5730559C18Rik G T 1: 136,214,350 N670K probably benign Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Atad2 A G 15: 58,116,856 S411P probably damaging Het
Cdhr2 G A 13: 54,714,005 V72I probably damaging Het
Celf4 T C 18: 25,491,201 I414V probably damaging Het
Cfap43 G A 19: 47,782,405 T689I probably benign Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp3a11 A T 5: 145,869,195 S121T probably benign Het
Dip2c C A 13: 9,609,056 Q864K probably damaging Het
Fbxo3 A G 2: 104,051,165 T281A probably damaging Het
Gm5148 T A 3: 37,714,609 H154L unknown Het
Gm906 A C 13: 50,250,105 S54A probably benign Het
Gsdma2 T A 11: 98,651,932 probably null Het
Hfm1 T C 5: 106,904,797 I273M possibly damaging Het
Hspa4l A G 3: 40,746,003 E14G probably benign Het
Lgals12 T G 19: 7,606,716 E5D possibly damaging Het
Mettl14 T C 3: 123,383,605 E49G probably damaging Het
Nbeal1 A G 1: 60,330,948 I2675V probably benign Het
Olfr1272 A T 2: 90,282,062 V171E probably damaging Het
Olfr1391 A T 11: 49,327,477 Q22L probably benign Het
Olfr178 T G 16: 58,889,780 S147R probably benign Het
Padi1 A T 4: 140,814,778 L611Q probably damaging Het
Pcdhac2 A G 18: 37,144,711 D248G probably damaging Het
Plekhm1 C A 11: 103,370,934 R940L probably damaging Het
Rasa3 A G 8: 13,614,532 probably null Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Sacs A G 14: 61,206,337 Y1944C probably damaging Het
Slc7a10 G T 7: 35,198,715 M297I probably damaging Het
Ssh2 A G 11: 77,408,183 T112A possibly damaging Het
Ttc7 A T 17: 87,321,401 probably null Het
Vmn1r64 T A 7: 5,883,896 H216L probably benign Het
Vmn2r112 A G 17: 22,618,412 K618R probably damaging Het
Vmp1 T A 11: 86,661,188 I117L probably benign Het
Vsnl1 A T 12: 11,332,055 Y108* probably null Het
Wdr31 A G 4: 62,457,438 probably null Het
Zfp329 A G 7: 12,807,913 V284A probably benign Het
Zfp551 G A 7: 12,416,391 H364Y possibly damaging Het
Other mutations in Lsg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01765:Lsg1 APN 16 30582095 missense probably damaging 1.00
IGL02023:Lsg1 APN 16 30585676 missense probably damaging 1.00
IGL02530:Lsg1 APN 16 30571242 missense probably benign 0.31
IGL02647:Lsg1 APN 16 30585552 critical splice donor site probably null
IGL02710:Lsg1 APN 16 30571474 missense probably benign
IGL02714:Lsg1 APN 16 30585550 splice site probably null
IGL02938:Lsg1 APN 16 30571206 missense probably benign
R1349:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1372:Lsg1 UTSW 16 30564654 missense possibly damaging 0.94
R1569:Lsg1 UTSW 16 30581005 splice site probably null
R1667:Lsg1 UTSW 16 30571352 missense probably damaging 1.00
R2445:Lsg1 UTSW 16 30564695 missense probably benign 0.01
R2991:Lsg1 UTSW 16 30561729 missense probably damaging 0.97
R3611:Lsg1 UTSW 16 30561795 missense probably benign 0.04
R4700:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R4750:Lsg1 UTSW 16 30565449 missense probably damaging 0.99
R5114:Lsg1 UTSW 16 30561720 missense probably damaging 1.00
R5580:Lsg1 UTSW 16 30569167 missense probably null 0.91
R5589:Lsg1 UTSW 16 30581001 missense probably damaging 1.00
R5719:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R5721:Lsg1 UTSW 16 30561775 missense probably benign 0.00
R6377:Lsg1 UTSW 16 30574568 missense possibly damaging 0.95
R6899:Lsg1 UTSW 16 30582088 missense probably benign
R7469:Lsg1 UTSW 16 30561817 missense probably benign 0.08
R7530:Lsg1 UTSW 16 30582601 missense possibly damaging 0.65
R7737:Lsg1 UTSW 16 30581185 splice site probably null
R7869:Lsg1 UTSW 16 30564722 missense probably benign 0.00
R8198:Lsg1 UTSW 16 30564776 missense probably benign
R8439:Lsg1 UTSW 16 30561751 missense probably damaging 1.00
X0065:Lsg1 UTSW 16 30571458 missense probably benign
Z1177:Lsg1 UTSW 16 30573289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCCATGTGGTCTGGTTAC -3'
(R):5'- TGATGAGCCCAGCTGTTGTC -3'

Sequencing Primer
(F):5'- CTCCTGTAATCACTGAACTGGGG -3'
(R):5'- CCAGCTGTTGTCTGAGGAC -3'
Posted On2015-06-20