Incidental Mutation 'R4257:Upp2'
ID321848
Institutional Source Beutler Lab
Gene Symbol Upp2
Ensembl Gene ENSMUSG00000026839
Gene Nameuridine phosphorylase 2
SynonymsUDRPASE2, UP2, UPASE2, 1700124F02Rik
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location58567298-58792971 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58780094 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 219 (I219F)
Ref Sequence ENSEMBL: ENSMUSP00000154977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059102] [ENSMUST00000071543] [ENSMUST00000102755] [ENSMUST00000229923] [ENSMUST00000230627]
Predicted Effect probably damaging
Transcript: ENSMUST00000059102
AA Change: I271F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000060437
Gene: ENSMUSG00000026839
AA Change: I271F

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 78 328 6.4e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071543
AA Change: I291F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071474
Gene: ENSMUSG00000026839
AA Change: I291F

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Pfam:PNP_UDP_1 98 316 7.1e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102755
AA Change: I253F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099816
Gene: ENSMUSG00000026839
AA Change: I253F

DomainStartEndE-ValueType
Pfam:PNP_UDP_1 60 310 4.2e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128864
Predicted Effect probably damaging
Transcript: ENSMUST00000229923
AA Change: I253F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230627
AA Change: I219F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5781 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Upp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Upp2 APN 2 58790064 missense probably benign 0.43
IGL01716:Upp2 APN 2 58790046 missense probably damaging 0.99
IGL02069:Upp2 APN 2 58771417 splice site probably benign
IGL02349:Upp2 APN 2 58777886 missense probably benign 0.03
IGL03072:Upp2 APN 2 58755423 critical splice donor site probably null
R0815:Upp2 UTSW 2 58771556 missense probably benign 0.00
R1164:Upp2 UTSW 2 58763704 missense probably damaging 1.00
R1400:Upp2 UTSW 2 58790106 missense probably damaging 1.00
R1553:Upp2 UTSW 2 58790140 missense probably damaging 1.00
R1581:Upp2 UTSW 2 58774165 missense possibly damaging 0.93
R1674:Upp2 UTSW 2 58790064 missense probably benign 0.43
R1702:Upp2 UTSW 2 58771550 missense possibly damaging 0.86
R1902:Upp2 UTSW 2 58771452 missense probably damaging 1.00
R2351:Upp2 UTSW 2 58763662 splice site probably null
R3011:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R3622:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3623:Upp2 UTSW 2 58790116 missense possibly damaging 0.83
R3731:Upp2 UTSW 2 58755367 missense probably benign 0.02
R4296:Upp2 UTSW 2 58778009 missense probably damaging 1.00
R4768:Upp2 UTSW 2 58777895 missense probably damaging 0.99
R5116:Upp2 UTSW 2 58771542 missense probably damaging 1.00
R5638:Upp2 UTSW 2 58790095 missense probably damaging 0.97
R7100:Upp2 UTSW 2 58791805 missense probably benign
R7421:Upp2 UTSW 2 58771574 missense possibly damaging 0.49
R7727:Upp2 UTSW 2 58774148 missense possibly damaging 0.95
R7840:Upp2 UTSW 2 58774115 critical splice acceptor site probably null
R8033:Upp2 UTSW 2 58780059 missense probably damaging 1.00
R8359:Upp2 UTSW 2 58777943 missense probably benign 0.05
R8461:Upp2 UTSW 2 58780056 missense probably benign 0.02
R8510:Upp2 UTSW 2 58780106 missense probably damaging 1.00
Z1177:Upp2 UTSW 2 58780062 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCAGACAGCCTTCTGAGG -3'
(R):5'- TGATGGGAGCAGTGTCCTAC -3'

Sequencing Primer
(F):5'- AGCCTTCTGAGGATGCTTCTGC -3'
(R):5'- TACCCGCTCACAAATCTCTATGAG -3'
Posted On2015-06-20