Incidental Mutation 'R4257:Olfr1176'
ID321850
Institutional Source Beutler Lab
Gene Symbol Olfr1176
Ensembl Gene ENSMUSG00000050023
Gene Nameolfactory receptor 1176
SynonymsMOR174-5, GA_x6K02T2Q125-49824309-49825256
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.048) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88336721-88342048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 88340277 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 237 (K237N)
Ref Sequence ENSEMBL: ENSMUSP00000149943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057439] [ENSMUST00000137895] [ENSMUST00000213778] [ENSMUST00000216713]
Predicted Effect probably damaging
Transcript: ENSMUST00000057439
AA Change: K237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053353
Gene: ENSMUSG00000050023
AA Change: K237N

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
Pfam:7tm_4 32 309 5.3e-46 PFAM
Pfam:7tm_1 42 291 4.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137895
Predicted Effect probably damaging
Transcript: ENSMUST00000213778
AA Change: K237N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216713
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Olfr1176
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01736:Olfr1176 APN 2 88340427 missense probably damaging 1.00
IGL02166:Olfr1176 APN 2 88339678 missense probably damaging 0.97
IGL02340:Olfr1176 APN 2 88339562 unclassified probably benign
IGL02598:Olfr1176 APN 2 88340251 missense possibly damaging 0.64
IGL03069:Olfr1176 APN 2 88340299 splice site probably null
IGL03212:Olfr1176 APN 2 88339672 missense probably damaging 1.00
R1959:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R1960:Olfr1176 UTSW 2 88340201 missense probably damaging 1.00
R2907:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R2908:Olfr1176 UTSW 2 88340483 missense probably benign 0.11
R4049:Olfr1176 UTSW 2 88343800 splice site probably null
R4823:Olfr1176 UTSW 2 88339835 missense probably damaging 0.96
R4897:Olfr1176 UTSW 2 88344342 missense possibly damaging 0.89
R5106:Olfr1176 UTSW 2 88340110 missense probably benign 0.07
R5192:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5196:Olfr1176 UTSW 2 88339748 missense possibly damaging 0.94
R5331:Olfr1176 UTSW 2 88339988 missense probably damaging 1.00
R5579:Olfr1176 UTSW 2 88340413 missense possibly damaging 0.83
R6283:Olfr1176 UTSW 2 88339658 missense probably benign 0.33
R6702:Olfr1176 UTSW 2 88340242 missense probably benign 0.02
R8155:Olfr1176 UTSW 2 88339952 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTTGCTGTGAGTACTCTGCC -3'
(R):5'- TGACTGAGAAAGGATTTTCATATGG -3'

Sequencing Primer
(F):5'- GAGTACTCTGCCATAATTTCTGCAG -3'
(R):5'- TCATATGGATTAATTTCCTCACAGTC -3'
Posted On2015-06-20