Incidental Mutation 'R4257:Arhgap24'
ID321857
Institutional Source Beutler Lab
Gene Symbol Arhgap24
Ensembl Gene ENSMUSG00000057315
Gene NameRho GTPase activating protein 24
Synonyms0610025G21Rik
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location102481391-102897937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102664117 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 70 (E70G)
Ref Sequence ENSEMBL: ENSMUSP00000092138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073302] [ENSMUST00000094559] [ENSMUST00000112854]
Predicted Effect probably benign
Transcript: ENSMUST00000073302
SMART Domains Protein: ENSMUSP00000073028
Gene: ENSMUSG00000057315

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094559
AA Change: E70G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000092138
Gene: ENSMUSG00000057315
AA Change: E70G

DomainStartEndE-ValueType
PH 18 125 5.35e-23 SMART
RhoGAP 148 324 7.04e-67 SMART
low complexity region 566 577 N/A INTRINSIC
low complexity region 610 629 N/A INTRINSIC
coiled coil region 648 728 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112854
SMART Domains Protein: ENSMUSP00000108475
Gene: ENSMUSG00000057315

DomainStartEndE-ValueType
Blast:RhoGAP 1 38 5e-16 BLAST
RhoGAP 55 231 7.04e-67 SMART
low complexity region 473 484 N/A INTRINSIC
low complexity region 517 536 N/A INTRINSIC
coiled coil region 555 635 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126125
Meta Mutation Damage Score 0.1525 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a Rho-GTPase activating protein, which is specific for the small GTPase family member Rac. Binding of the encoded protein by filamin A targets it to sites of membrane protrusion, where it antognizes Rac. This results in suppression of lamellae formation and promotion of retraction to regulate cell polarity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Arhgap24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Arhgap24 APN 5 102860399 missense possibly damaging 0.94
IGL01483:Arhgap24 APN 5 102860377 missense possibly damaging 0.91
IGL02641:Arhgap24 APN 5 102892520 missense probably damaging 1.00
IGL03166:Arhgap24 APN 5 102875686 splice site probably benign
R0506:Arhgap24 UTSW 5 102875777 missense probably damaging 0.99
R0606:Arhgap24 UTSW 5 102897220 missense probably damaging 1.00
R1457:Arhgap24 UTSW 5 102664106 missense probably damaging 0.98
R1491:Arhgap24 UTSW 5 102860332 missense possibly damaging 0.47
R1707:Arhgap24 UTSW 5 102892087 missense probably benign 0.40
R2112:Arhgap24 UTSW 5 102892500 missense probably damaging 1.00
R2300:Arhgap24 UTSW 5 102860425 missense probably damaging 1.00
R2516:Arhgap24 UTSW 5 102891910 missense probably benign
R3803:Arhgap24 UTSW 5 102892442 missense probably damaging 0.98
R4761:Arhgap24 UTSW 5 102664214 intron probably benign
R5045:Arhgap24 UTSW 5 102891877 missense possibly damaging 0.79
R5121:Arhgap24 UTSW 5 102841335 missense probably damaging 1.00
R5209:Arhgap24 UTSW 5 102892149 missense probably benign 0.12
R5667:Arhgap24 UTSW 5 102846171 critical splice donor site probably null
R5914:Arhgap24 UTSW 5 102552159 intron probably null
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6039:Arhgap24 UTSW 5 102880786 missense probably damaging 0.98
R6158:Arhgap24 UTSW 5 102892912 missense probably benign 0.12
R6410:Arhgap24 UTSW 5 102892151 missense probably benign 0.10
R6450:Arhgap24 UTSW 5 102897124 missense probably benign 0.01
R6520:Arhgap24 UTSW 5 102880793 missense probably benign 0.00
R6666:Arhgap24 UTSW 5 102552297 intron probably null
R7233:Arhgap24 UTSW 5 102878501 missense probably benign 0.03
R7311:Arhgap24 UTSW 5 102892685 missense probably damaging 1.00
R7460:Arhgap24 UTSW 5 102892346 missense probably benign 0.36
R7483:Arhgap24 UTSW 5 102841308 missense probably benign 0.13
R7515:Arhgap24 UTSW 5 102846016 intron probably benign
R7667:Arhgap24 UTSW 5 102878457 missense probably benign
R8227:Arhgap24 UTSW 5 102875781 missense not run
Z1176:Arhgap24 UTSW 5 102875759 missense probably damaging 0.97
Z1176:Arhgap24 UTSW 5 102880807 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTTGTCTAATGCACATGAGCTACTC -3'
(R):5'- GCCAAGTAAATGCTTGCTCTCTC -3'

Sequencing Primer
(F):5'- CTCTGGCTTATGGAATTTGATTACC -3'
(R):5'- TCTCAATTTTCAGCCAGAATCAACG -3'
Posted On2015-06-20