Incidental Mutation 'R4257:Ryr1'
ID 321860
Institutional Source Beutler Lab
Gene Symbol Ryr1
Ensembl Gene ENSMUSG00000030592
Gene Name ryanodine receptor 1, skeletal muscle
Synonyms skrr, calcium release channel isoform 1, Ryr
MMRRC Submission 041070-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4257 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 29003344-29125179 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 29082450 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 2038 (D2038G)
Ref Sequence ENSEMBL: ENSMUSP00000137123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032813] [ENSMUST00000179893] [ENSMUST00000214374]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000032813
AA Change: D2038G

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032813
Gene: ENSMUSG00000030592
AA Change: D2038G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 441 645 1.2e-73 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 851 945 6.5e-33 PFAM
Pfam:RyR 965 1059 1.5e-30 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2158 2366 7e-66 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2735 2829 9.7e-34 PFAM
Pfam:RyR 2855 2943 5.7e-32 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3613 3642 2e-13 PDB
low complexity region 3681 3691 N/A INTRINSIC
low complexity region 3735 3760 N/A INTRINSIC
Pfam:RIH_assoc 3872 4004 1.9e-41 PFAM
low complexity region 4010 4023 N/A INTRINSIC
Pfam:EF-hand_8 4085 4136 9.8e-8 PFAM
transmembrane domain 4283 4305 N/A INTRINSIC
transmembrane domain 4318 4336 N/A INTRINSIC
transmembrane domain 4341 4363 N/A INTRINSIC
Pfam:RR_TM4-6 4377 4666 2e-86 PFAM
Pfam:Ion_trans 4761 4932 3.4e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158594
Predicted Effect possibly damaging
Transcript: ENSMUST00000179893
AA Change: D2038G

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137123
Gene: ENSMUSG00000030592
AA Change: D2038G

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
MIR 99 154 7.52e-4 SMART
MIR 161 206 1.11e-6 SMART
MIR 212 266 1.23e-8 SMART
MIR 272 362 1.05e-25 SMART
Pfam:RYDR_ITPR 443 638 4.5e-63 PFAM
SPRY 660 798 2.79e-27 SMART
Pfam:RyR 852 942 1.3e-37 PFAM
Pfam:RyR 966 1056 1.6e-28 PFAM
SPRY 1086 1209 8.62e-42 SMART
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1340 1349 N/A INTRINSIC
SPRY 1431 1571 3.05e-33 SMART
low complexity region 1787 1798 N/A INTRINSIC
coiled coil region 1871 1932 N/A INTRINSIC
low complexity region 1989 1998 N/A INTRINSIC
low complexity region 2048 2057 N/A INTRINSIC
low complexity region 2069 2092 N/A INTRINSIC
Pfam:RYDR_ITPR 2160 2366 2.2e-68 PFAM
low complexity region 2390 2404 N/A INTRINSIC
Pfam:RyR 2736 2826 7.2e-31 PFAM
Pfam:RyR 2856 2940 5.6e-27 PFAM
low complexity region 3130 3144 N/A INTRINSIC
low complexity region 3290 3304 N/A INTRINSIC
low complexity region 3375 3394 N/A INTRINSIC
PDB:2BCX|B 3615 3644 2e-13 PDB
low complexity region 3683 3693 N/A INTRINSIC
low complexity region 3737 3762 N/A INTRINSIC
Pfam:RIH_assoc 3878 3996 6.2e-35 PFAM
low complexity region 4012 4025 N/A INTRINSIC
Pfam:EF-hand_8 4087 4137 1.8e-8 PFAM
transmembrane domain 4285 4307 N/A INTRINSIC
transmembrane domain 4320 4338 N/A INTRINSIC
transmembrane domain 4343 4365 N/A INTRINSIC
Pfam:RR_TM4-6 4379 4668 8.4e-76 PFAM
Pfam:Ion_trans 4763 4946 2.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180926
Predicted Effect possibly damaging
Transcript: ENSMUST00000214374
AA Change: D2045G

PolyPhen 2 Score 0.894 (Sensitivity: 0.82; Specificity: 0.94)
Meta Mutation Damage Score 0.1036 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in skeletal muscle. The encoded protein functions as a calcium release channel in the sarcoplasmic reticulum but also serves to connect the sarcoplasmic reticulum and transverse tubule. Mutations in this gene are associated with malignant hyperthermia susceptibility, central core disease, and minicore myopathy with external ophthalmoplegia. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation and a similar ENU-induced mutation are born with a rounded body shape, edema, thin and misshapened ribs, and abnormal muscle fibers. Mutants die perinatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 (GRCm38) probably benign Het
4930578I06Rik C T 14: 63,973,209 (GRCm38) R190H probably benign Het
Akap13 T A 7: 75,611,285 (GRCm38) I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 (GRCm38) probably benign Het
Arhgap24 A G 5: 102,664,117 (GRCm38) E70G probably benign Het
Arsi G A 18: 60,916,651 (GRCm38) G202E probably benign Het
Babam2 T C 5: 31,702,070 (GRCm38) S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 (GRCm38) V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 (GRCm38) E508G probably damaging Het
Ckm T C 7: 19,421,354 (GRCm38) S372P probably benign Het
Egflam T A 15: 7,254,426 (GRCm38) probably null Het
Farp1 G A 14: 121,255,479 (GRCm38) V498M probably benign Het
Galnt14 T A 17: 73,504,904 (GRCm38) I441F probably benign Het
Gm5414 A G 15: 101,624,672 (GRCm38) L440P probably damaging Het
Gm6563 A G 19: 23,675,975 (GRCm38) E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 (GRCm38) noncoding transcript Het
Gmds A G 13: 31,820,189 (GRCm38) S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 (GRCm38) Q754L unknown Het
Ltk G A 2: 119,753,004 (GRCm38) T300I possibly damaging Het
Or5d46 A C 2: 88,340,277 (GRCm38) K237N probably damaging Het
Pbx2 C A 17: 34,594,645 (GRCm38) H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 (GRCm38) F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 (GRCm38) D353E probably benign Het
Prss36 G A 7: 127,932,838 (GRCm38) probably benign Het
Rimbp2 A G 5: 128,774,260 (GRCm38) V874A probably damaging Het
Rspo2 C A 15: 43,075,911 (GRCm38) R161L probably benign Het
Stkld1 A G 2: 26,943,134 (GRCm38) M111V probably benign Het
Tprn A G 2: 25,264,482 (GRCm38) I599V probably damaging Het
Upp2 A T 2: 58,780,094 (GRCm38) I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 (GRCm38) F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 (GRCm38) T2875A probably benign Het
Zfp64 A G 2: 168,926,378 (GRCm38) L438P probably damaging Het
Other mutations in Ryr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ryr1 APN 7 29,102,810 (GRCm38) missense probably damaging 1.00
IGL00335:Ryr1 APN 7 29,124,960 (GRCm38) splice site probably null
IGL00427:Ryr1 APN 7 29,104,737 (GRCm38) splice site probably benign
IGL00559:Ryr1 APN 7 29,012,242 (GRCm38) splice site probably benign
IGL00803:Ryr1 APN 7 29,069,645 (GRCm38) missense possibly damaging 0.95
IGL00886:Ryr1 APN 7 29,024,229 (GRCm38) missense probably damaging 1.00
IGL00948:Ryr1 APN 7 29,020,195 (GRCm38) missense possibly damaging 0.78
IGL01017:Ryr1 APN 7 29,082,543 (GRCm38) missense probably damaging 0.99
IGL01116:Ryr1 APN 7 29,100,202 (GRCm38) splice site probably benign
IGL01385:Ryr1 APN 7 29,056,985 (GRCm38) missense probably damaging 1.00
IGL01482:Ryr1 APN 7 29,052,337 (GRCm38) missense probably damaging 1.00
IGL01529:Ryr1 APN 7 29,075,227 (GRCm38) missense probably damaging 1.00
IGL01543:Ryr1 APN 7 29,091,076 (GRCm38) missense probably damaging 1.00
IGL01653:Ryr1 APN 7 29,078,597 (GRCm38) missense probably damaging 0.99
IGL01701:Ryr1 APN 7 29,059,810 (GRCm38) missense probably damaging 0.98
IGL02051:Ryr1 APN 7 29,071,658 (GRCm38) missense probably benign 0.16
IGL02152:Ryr1 APN 7 29,052,015 (GRCm38) missense possibly damaging 0.95
IGL02271:Ryr1 APN 7 29,094,047 (GRCm38) missense probably benign 0.07
IGL02321:Ryr1 APN 7 29,078,696 (GRCm38) missense probably damaging 1.00
IGL02448:Ryr1 APN 7 29,105,066 (GRCm38) splice site probably benign
IGL02472:Ryr1 APN 7 29,040,844 (GRCm38) missense probably damaging 1.00
IGL02544:Ryr1 APN 7 29,115,599 (GRCm38) missense probably benign 0.24
IGL02666:Ryr1 APN 7 29,019,763 (GRCm38) missense unknown
IGL02672:Ryr1 APN 7 29,004,519 (GRCm38) unclassified probably benign
IGL02677:Ryr1 APN 7 29,110,608 (GRCm38) missense probably benign 0.18
IGL02686:Ryr1 APN 7 29,069,550 (GRCm38) splice site probably benign
IGL02751:Ryr1 APN 7 29,078,774 (GRCm38) missense probably damaging 1.00
IGL02899:Ryr1 APN 7 29,048,795 (GRCm38) missense possibly damaging 0.53
IGL02926:Ryr1 APN 7 29,061,540 (GRCm38) missense probably damaging 1.00
IGL02950:Ryr1 APN 7 29,097,459 (GRCm38) missense probably damaging 1.00
IGL02960:Ryr1 APN 7 29,060,053 (GRCm38) missense probably damaging 1.00
IGL02968:Ryr1 APN 7 29,043,893 (GRCm38) missense probably damaging 1.00
IGL03070:Ryr1 APN 7 29,070,659 (GRCm38) missense probably damaging 1.00
IGL03091:Ryr1 APN 7 29,083,486 (GRCm38) missense possibly damaging 0.85
IGL03100:Ryr1 APN 7 29,104,593 (GRCm38) missense probably damaging 1.00
IGL03107:Ryr1 APN 7 29,075,199 (GRCm38) missense probably damaging 1.00
IGL03117:Ryr1 APN 7 29,102,964 (GRCm38) missense probably damaging 1.00
IGL03118:Ryr1 APN 7 29,015,786 (GRCm38) missense unknown
IGL03146:Ryr1 APN 7 29,094,032 (GRCm38) missense probably benign 0.09
IGL03165:Ryr1 APN 7 29,105,040 (GRCm38) missense probably benign 0.22
IGL03220:Ryr1 APN 7 29,059,855 (GRCm38) missense probably damaging 1.00
R0017:Ryr1 UTSW 7 29,047,542 (GRCm38) missense probably damaging 1.00
R0066:Ryr1 UTSW 7 29,005,567 (GRCm38) unclassified probably benign
R0066:Ryr1 UTSW 7 29,005,567 (GRCm38) unclassified probably benign
R0069:Ryr1 UTSW 7 29,110,505 (GRCm38) splice site probably benign
R0148:Ryr1 UTSW 7 29,052,035 (GRCm38) missense probably damaging 0.99
R0266:Ryr1 UTSW 7 29,040,679 (GRCm38) missense probably damaging 1.00
R0346:Ryr1 UTSW 7 29,067,588 (GRCm38) splice site probably benign
R0387:Ryr1 UTSW 7 29,083,367 (GRCm38) splice site probably benign
R0454:Ryr1 UTSW 7 29,036,075 (GRCm38) missense probably damaging 0.99
R0494:Ryr1 UTSW 7 29,003,793 (GRCm38) splice site probably benign
R0533:Ryr1 UTSW 7 29,078,780 (GRCm38) missense probably damaging 1.00
R0585:Ryr1 UTSW 7 29,036,076 (GRCm38) missense probably damaging 1.00
R0591:Ryr1 UTSW 7 29,104,795 (GRCm38) missense possibly damaging 0.68
R0624:Ryr1 UTSW 7 29,074,609 (GRCm38) missense probably damaging 1.00
R0662:Ryr1 UTSW 7 29,100,189 (GRCm38) missense probably damaging 1.00
R0849:Ryr1 UTSW 7 29,040,679 (GRCm38) missense probably damaging 1.00
R0961:Ryr1 UTSW 7 29,009,697 (GRCm38) missense unknown
R1052:Ryr1 UTSW 7 29,096,258 (GRCm38) missense probably damaging 0.96
R1218:Ryr1 UTSW 7 29,086,109 (GRCm38) missense possibly damaging 0.79
R1340:Ryr1 UTSW 7 29,116,012 (GRCm38) missense probably damaging 0.99
R1513:Ryr1 UTSW 7 29,070,621 (GRCm38) missense probably damaging 1.00
R1543:Ryr1 UTSW 7 29,083,537 (GRCm38) missense possibly damaging 0.67
R1566:Ryr1 UTSW 7 29,092,175 (GRCm38) missense possibly damaging 0.95
R1572:Ryr1 UTSW 7 29,062,191 (GRCm38) missense probably damaging 1.00
R1623:Ryr1 UTSW 7 29,095,490 (GRCm38) missense probably damaging 1.00
R1632:Ryr1 UTSW 7 29,094,261 (GRCm38) missense probably benign 0.03
R1661:Ryr1 UTSW 7 29,101,738 (GRCm38) missense probably damaging 0.98
R1665:Ryr1 UTSW 7 29,036,078 (GRCm38) missense probably damaging 1.00
R1678:Ryr1 UTSW 7 29,116,154 (GRCm38) missense probably damaging 0.99
R1705:Ryr1 UTSW 7 29,078,564 (GRCm38) missense probably damaging 1.00
R1712:Ryr1 UTSW 7 29,047,503 (GRCm38) missense probably benign 0.25
R1720:Ryr1 UTSW 7 29,101,870 (GRCm38) missense probably damaging 0.99
R1799:Ryr1 UTSW 7 29,067,621 (GRCm38) missense probably damaging 1.00
R1847:Ryr1 UTSW 7 29,079,811 (GRCm38) missense probably benign 0.43
R1860:Ryr1 UTSW 7 29,009,552 (GRCm38) missense unknown
R1861:Ryr1 UTSW 7 29,009,552 (GRCm38) missense unknown
R1921:Ryr1 UTSW 7 29,054,944 (GRCm38) missense probably damaging 1.00
R1983:Ryr1 UTSW 7 29,059,472 (GRCm38) missense possibly damaging 0.74
R2043:Ryr1 UTSW 7 29,059,631 (GRCm38) missense probably damaging 0.99
R2089:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2091:Ryr1 UTSW 7 29,086,049 (GRCm38) missense probably damaging 1.00
R2105:Ryr1 UTSW 7 29,090,150 (GRCm38) missense probably damaging 0.99
R2175:Ryr1 UTSW 7 29,068,442 (GRCm38) missense probably damaging 1.00
R2259:Ryr1 UTSW 7 29,019,741 (GRCm38) missense unknown
R2291:Ryr1 UTSW 7 29,098,777 (GRCm38) missense probably damaging 1.00
R2351:Ryr1 UTSW 7 29,075,293 (GRCm38) missense probably benign 0.18
R2512:Ryr1 UTSW 7 29,103,542 (GRCm38) missense possibly damaging 0.64
R2571:Ryr1 UTSW 7 29,036,126 (GRCm38) missense possibly damaging 0.94
R2571:Ryr1 UTSW 7 29,009,562 (GRCm38) missense unknown
R2885:Ryr1 UTSW 7 29,074,798 (GRCm38) missense probably damaging 0.99
R2886:Ryr1 UTSW 7 29,074,798 (GRCm38) missense probably damaging 0.99
R2889:Ryr1 UTSW 7 29,078,741 (GRCm38) missense possibly damaging 0.76
R3051:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3052:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3053:Ryr1 UTSW 7 29,053,090 (GRCm38) missense probably damaging 1.00
R3082:Ryr1 UTSW 7 29,045,646 (GRCm38) missense probably damaging 1.00
R3103:Ryr1 UTSW 7 29,074,948 (GRCm38) missense probably damaging 1.00
R3237:Ryr1 UTSW 7 29,069,650 (GRCm38) critical splice acceptor site probably null
R3551:Ryr1 UTSW 7 29,056,997 (GRCm38) missense probably damaging 1.00
R3552:Ryr1 UTSW 7 29,056,997 (GRCm38) missense probably damaging 1.00
R3807:Ryr1 UTSW 7 29,020,152 (GRCm38) missense probably damaging 1.00
R3815:Ryr1 UTSW 7 29,072,902 (GRCm38) missense probably damaging 0.98
R4010:Ryr1 UTSW 7 29,095,124 (GRCm38) missense probably benign 0.41
R4041:Ryr1 UTSW 7 29,085,931 (GRCm38) missense possibly damaging 0.77
R4226:Ryr1 UTSW 7 29,062,151 (GRCm38) nonsense probably null
R4328:Ryr1 UTSW 7 29,083,059 (GRCm38) missense probably damaging 1.00
R4394:Ryr1 UTSW 7 29,094,242 (GRCm38) missense possibly damaging 0.69
R4485:Ryr1 UTSW 7 29,090,156 (GRCm38) missense probably damaging 0.97
R4550:Ryr1 UTSW 7 29,098,735 (GRCm38) missense probably benign 0.05
R4554:Ryr1 UTSW 7 29,105,008 (GRCm38) missense probably benign 0.03
R4562:Ryr1 UTSW 7 29,074,580 (GRCm38) intron probably benign
R4642:Ryr1 UTSW 7 29,086,038 (GRCm38) missense possibly damaging 0.91
R4669:Ryr1 UTSW 7 29,059,831 (GRCm38) missense probably null 0.99
R4707:Ryr1 UTSW 7 29,045,662 (GRCm38) missense probably damaging 1.00
R4766:Ryr1 UTSW 7 29,085,833 (GRCm38) missense probably damaging 0.96
R4768:Ryr1 UTSW 7 29,004,821 (GRCm38) unclassified probably benign
R4770:Ryr1 UTSW 7 29,109,282 (GRCm38) missense probably damaging 0.99
R4780:Ryr1 UTSW 7 29,095,097 (GRCm38) missense possibly damaging 0.85
R4927:Ryr1 UTSW 7 29,019,983 (GRCm38) missense unknown
R4933:Ryr1 UTSW 7 29,104,298 (GRCm38) missense probably damaging 1.00
R4934:Ryr1 UTSW 7 29,068,095 (GRCm38) missense probably damaging 1.00
R4942:Ryr1 UTSW 7 29,069,573 (GRCm38) missense probably damaging 0.98
R4960:Ryr1 UTSW 7 29,078,783 (GRCm38) missense possibly damaging 0.82
R5007:Ryr1 UTSW 7 29,069,115 (GRCm38) missense probably damaging 1.00
R5011:Ryr1 UTSW 7 29,102,809 (GRCm38) splice site probably null
R5013:Ryr1 UTSW 7 29,102,809 (GRCm38) splice site probably null
R5137:Ryr1 UTSW 7 29,101,858 (GRCm38) missense possibly damaging 0.94
R5167:Ryr1 UTSW 7 29,067,693 (GRCm38) missense probably damaging 1.00
R5239:Ryr1 UTSW 7 29,036,128 (GRCm38) missense probably damaging 1.00
R5291:Ryr1 UTSW 7 29,115,598 (GRCm38) missense probably benign 0.03
R5303:Ryr1 UTSW 7 29,068,482 (GRCm38) missense probably damaging 1.00
R5386:Ryr1 UTSW 7 29,117,416 (GRCm38) missense probably damaging 0.98
R5431:Ryr1 UTSW 7 29,109,812 (GRCm38) missense probably benign 0.39
R5460:Ryr1 UTSW 7 29,071,961 (GRCm38) missense probably damaging 1.00
R5463:Ryr1 UTSW 7 29,024,023 (GRCm38) missense possibly damaging 0.79
R5503:Ryr1 UTSW 7 29,069,028 (GRCm38) missense possibly damaging 0.87
R5541:Ryr1 UTSW 7 29,086,185 (GRCm38) missense probably damaging 1.00
R5573:Ryr1 UTSW 7 29,015,723 (GRCm38) missense unknown
R5575:Ryr1 UTSW 7 29,078,693 (GRCm38) missense possibly damaging 0.77
R5610:Ryr1 UTSW 7 29,111,974 (GRCm38) missense probably benign 0.05
R5658:Ryr1 UTSW 7 29,091,089 (GRCm38) splice site probably null
R5918:Ryr1 UTSW 7 29,009,152 (GRCm38) missense probably benign 0.39
R5926:Ryr1 UTSW 7 29,104,360 (GRCm38) missense probably damaging 1.00
R5938:Ryr1 UTSW 7 29,046,865 (GRCm38) missense probably damaging 1.00
R5939:Ryr1 UTSW 7 29,116,127 (GRCm38) missense probably damaging 0.97
R5947:Ryr1 UTSW 7 29,071,924 (GRCm38) missense probably null 0.98
R5991:Ryr1 UTSW 7 29,104,610 (GRCm38) missense probably damaging 0.99
R5992:Ryr1 UTSW 7 29,067,637 (GRCm38) missense probably damaging 1.00
R5996:Ryr1 UTSW 7 29,024,241 (GRCm38) missense probably benign 0.38
R6075:Ryr1 UTSW 7 29,087,438 (GRCm38) missense probably damaging 1.00
R6091:Ryr1 UTSW 7 29,071,973 (GRCm38) missense probably benign 0.01
R6126:Ryr1 UTSW 7 29,076,239 (GRCm38) missense probably null 1.00
R6147:Ryr1 UTSW 7 29,085,914 (GRCm38) missense possibly damaging 0.88
R6235:Ryr1 UTSW 7 29,116,181 (GRCm38) missense probably benign 0.07
R6279:Ryr1 UTSW 7 29,087,428 (GRCm38) missense possibly damaging 0.93
R6381:Ryr1 UTSW 7 29,075,257 (GRCm38) missense possibly damaging 0.87
R6441:Ryr1 UTSW 7 29,059,695 (GRCm38) missense possibly damaging 0.95
R6443:Ryr1 UTSW 7 29,077,078 (GRCm38) missense probably damaging 0.97
R6459:Ryr1 UTSW 7 29,015,654 (GRCm38) missense probably benign 0.39
R6514:Ryr1 UTSW 7 29,046,841 (GRCm38) missense probably damaging 1.00
R6563:Ryr1 UTSW 7 29,095,492 (GRCm38) missense possibly damaging 0.92
R6660:Ryr1 UTSW 7 29,038,345 (GRCm38) critical splice donor site probably null
R6746:Ryr1 UTSW 7 29,117,404 (GRCm38) missense possibly damaging 0.56
R6785:Ryr1 UTSW 7 29,064,874 (GRCm38) missense probably benign 0.12
R6800:Ryr1 UTSW 7 29,024,316 (GRCm38) missense possibly damaging 0.95
R6939:Ryr1 UTSW 7 29,052,326 (GRCm38) missense possibly damaging 0.91
R6980:Ryr1 UTSW 7 29,109,387 (GRCm38) missense probably benign 0.03
R6995:Ryr1 UTSW 7 29,094,182 (GRCm38) missense probably damaging 0.97
R7065:Ryr1 UTSW 7 29,103,643 (GRCm38) missense probably damaging 1.00
R7123:Ryr1 UTSW 7 29,046,854 (GRCm38) missense probably benign 0.37
R7238:Ryr1 UTSW 7 29,095,382 (GRCm38) missense probably benign 0.24
R7240:Ryr1 UTSW 7 29,052,015 (GRCm38) missense possibly damaging 0.95
R7300:Ryr1 UTSW 7 29,059,511 (GRCm38) missense probably damaging 1.00
R7365:Ryr1 UTSW 7 29,085,755 (GRCm38) missense probably benign 0.05
R7403:Ryr1 UTSW 7 29,013,867 (GRCm38) missense probably benign 0.34
R7422:Ryr1 UTSW 7 29,085,870 (GRCm38) missense probably benign 0.00
R7493:Ryr1 UTSW 7 29,095,205 (GRCm38) missense probably benign 0.44
R7570:Ryr1 UTSW 7 29,078,585 (GRCm38) missense probably damaging 0.98
R7593:Ryr1 UTSW 7 29,036,103 (GRCm38) missense probably damaging 1.00
R7769:Ryr1 UTSW 7 29,098,785 (GRCm38) missense probably damaging 1.00
R7781:Ryr1 UTSW 7 29,067,630 (GRCm38) missense probably damaging 1.00
R7790:Ryr1 UTSW 7 29,104,832 (GRCm38) missense probably benign 0.39
R7799:Ryr1 UTSW 7 29,003,560 (GRCm38) splice site probably null
R7916:Ryr1 UTSW 7 29,090,939 (GRCm38) nonsense probably null
R7922:Ryr1 UTSW 7 29,097,224 (GRCm38) missense probably benign 0.09
R7988:Ryr1 UTSW 7 29,096,171 (GRCm38) missense probably benign 0.29
R7997:Ryr1 UTSW 7 29,003,543 (GRCm38) missense unknown
R8052:Ryr1 UTSW 7 29,083,385 (GRCm38) missense probably benign 0.05
R8096:Ryr1 UTSW 7 29,009,201 (GRCm38) missense unknown
R8116:Ryr1 UTSW 7 29,110,883 (GRCm38) missense probably benign 0.03
R8202:Ryr1 UTSW 7 29,091,032 (GRCm38) missense probably benign 0.18
R8207:Ryr1 UTSW 7 29,090,225 (GRCm38) missense probably damaging 1.00
R8248:Ryr1 UTSW 7 29,069,121 (GRCm38) missense probably damaging 1.00
R8257:Ryr1 UTSW 7 29,064,639 (GRCm38) missense possibly damaging 0.82
R8354:Ryr1 UTSW 7 29,015,717 (GRCm38) missense unknown
R8454:Ryr1 UTSW 7 29,015,717 (GRCm38) missense unknown
R8487:Ryr1 UTSW 7 29,040,867 (GRCm38) missense probably damaging 0.97
R8529:Ryr1 UTSW 7 29,070,084 (GRCm38) missense possibly damaging 0.86
R8545:Ryr1 UTSW 7 29,004,814 (GRCm38) unclassified probably benign
R8678:Ryr1 UTSW 7 29,077,064 (GRCm38) missense probably damaging 0.99
R8717:Ryr1 UTSW 7 29,052,328 (GRCm38) missense probably benign 0.03
R8724:Ryr1 UTSW 7 29,117,377 (GRCm38) missense probably benign 0.04
R8755:Ryr1 UTSW 7 29,092,268 (GRCm38) missense probably benign 0.19
R8772:Ryr1 UTSW 7 29,116,132 (GRCm38) missense probably benign 0.05
R8790:Ryr1 UTSW 7 29,076,872 (GRCm38) missense probably damaging 1.00
R8793:Ryr1 UTSW 7 29,064,859 (GRCm38) missense probably damaging 1.00
R8836:Ryr1 UTSW 7 29,074,666 (GRCm38) missense probably damaging 1.00
R8858:Ryr1 UTSW 7 29,109,213 (GRCm38) missense probably benign 0.00
R8910:Ryr1 UTSW 7 29,071,915 (GRCm38) missense probably damaging 1.00
R8920:Ryr1 UTSW 7 29,090,215 (GRCm38) missense possibly damaging 0.89
R8938:Ryr1 UTSW 7 29,101,933 (GRCm38) missense probably damaging 1.00
R9035:Ryr1 UTSW 7 29,090,997 (GRCm38) missense probably damaging 0.97
R9115:Ryr1 UTSW 7 29,104,564 (GRCm38) nonsense probably null
R9123:Ryr1 UTSW 7 29,071,804 (GRCm38) missense probably damaging 1.00
R9154:Ryr1 UTSW 7 29,069,858 (GRCm38) missense probably benign 0.08
R9189:Ryr1 UTSW 7 29,077,046 (GRCm38) missense probably damaging 1.00
R9200:Ryr1 UTSW 7 29,095,099 (GRCm38) missense probably benign 0.00
R9214:Ryr1 UTSW 7 29,085,762 (GRCm38) missense possibly damaging 0.52
R9216:Ryr1 UTSW 7 29,101,852 (GRCm38) missense probably damaging 0.97
R9240:Ryr1 UTSW 7 29,043,888 (GRCm38) missense probably damaging 1.00
R9261:Ryr1 UTSW 7 29,052,388 (GRCm38) missense possibly damaging 0.91
R9276:Ryr1 UTSW 7 29,102,829 (GRCm38) missense probably damaging 0.99
R9280:Ryr1 UTSW 7 29,102,964 (GRCm38) missense probably damaging 1.00
R9316:Ryr1 UTSW 7 29,017,962 (GRCm38) missense unknown
R9333:Ryr1 UTSW 7 29,074,789 (GRCm38) critical splice donor site probably null
R9459:Ryr1 UTSW 7 29,068,643 (GRCm38) missense probably damaging 1.00
R9468:Ryr1 UTSW 7 29,073,085 (GRCm38) missense probably damaging 1.00
R9486:Ryr1 UTSW 7 29,078,540 (GRCm38) missense probably benign 0.15
R9524:Ryr1 UTSW 7 29,024,175 (GRCm38) missense probably damaging 1.00
R9620:Ryr1 UTSW 7 29,015,713 (GRCm38) missense unknown
R9664:Ryr1 UTSW 7 29,059,667 (GRCm38) missense probably damaging 1.00
R9776:Ryr1 UTSW 7 29,075,239 (GRCm38) missense probably damaging 1.00
X0021:Ryr1 UTSW 7 29,061,531 (GRCm38) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29,103,498 (GRCm38) missense probably damaging 1.00
Z1176:Ryr1 UTSW 7 29,086,035 (GRCm38) missense probably benign 0.10
Z1176:Ryr1 UTSW 7 29,020,214 (GRCm38) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29,101,922 (GRCm38) missense probably damaging 1.00
Z1177:Ryr1 UTSW 7 29,048,792 (GRCm38) nonsense probably null
Z1177:Ryr1 UTSW 7 29,017,985 (GRCm38) missense unknown
Z1186:Ryr1 UTSW 7 29,082,477 (GRCm38) missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- TATAGCGCCAATACACGGGC -3'
(R):5'- AAGGGGTCCTAGTCTTAGAGATTGATG -3'

Sequencing Primer
(F):5'- TTGGAACTCACTCTGTAGACCAGG -3'
(R):5'- ATGGTTGGATCTATGACCCTGATC -3'
Posted On 2015-06-20