Incidental Mutation 'R4257:Gm5414'
ID321872
Institutional Source Beutler Lab
Gene Symbol Gm5414
Ensembl Gene ENSMUSG00000064232
Gene Namepredicted gene 5414
Synonyms
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.197) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location101624028-101628188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101624672 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 440 (L440P)
Ref Sequence ENSEMBL: ENSMUSP00000059101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062879]
Predicted Effect probably damaging
Transcript: ENSMUST00000062879
AA Change: L440P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059101
Gene: ENSMUSG00000064232
AA Change: L440P

DomainStartEndE-ValueType
Pfam:Keratin_2_head 15 148 3.3e-29 PFAM
Filament 151 464 1.4e-143 SMART
low complexity region 489 507 N/A INTRINSIC
low complexity region 511 549 N/A INTRINSIC
Meta Mutation Damage Score 0.9333 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm6563 A G 19: 23,675,975 E43G possibly damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Gm5414
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Gm5414 APN 15 101628134 missense probably benign 0.00
IGL01774:Gm5414 APN 15 101626975 missense probably benign 0.13
IGL01939:Gm5414 APN 15 101625670 splice site probably benign
IGL02205:Gm5414 APN 15 101625869 missense probably benign 0.44
IGL02411:Gm5414 APN 15 101627834 missense probably benign 0.05
IGL02720:Gm5414 APN 15 101625555 missense probably damaging 1.00
IGL02900:Gm5414 APN 15 101627807 missense probably damaging 0.99
IGL03283:Gm5414 APN 15 101627087 missense probably damaging 1.00
PIT4480001:Gm5414 UTSW 15 101627746 missense probably damaging 1.00
PIT4504001:Gm5414 UTSW 15 101625823 missense probably damaging 0.98
R1905:Gm5414 UTSW 15 101624640 missense probably damaging 1.00
R2070:Gm5414 UTSW 15 101628060 missense possibly damaging 0.52
R3011:Gm5414 UTSW 15 101625612 missense probably damaging 1.00
R3033:Gm5414 UTSW 15 101624609 missense probably damaging 1.00
R4074:Gm5414 UTSW 15 101625553 missense probably benign
R4396:Gm5414 UTSW 15 101625666 missense probably damaging 1.00
R4648:Gm5414 UTSW 15 101628108 missense possibly damaging 0.72
R4912:Gm5414 UTSW 15 101625010 missense possibly damaging 0.46
R5095:Gm5414 UTSW 15 101624038 missense probably benign 0.01
R5135:Gm5414 UTSW 15 101627768 missense probably damaging 0.97
R5177:Gm5414 UTSW 15 101625817 missense possibly damaging 0.91
R5330:Gm5414 UTSW 15 101624664 missense probably damaging 1.00
R5331:Gm5414 UTSW 15 101624664 missense probably damaging 1.00
R5432:Gm5414 UTSW 15 101624634 missense probably damaging 1.00
R5521:Gm5414 UTSW 15 101627987 missense probably benign 0.33
R5623:Gm5414 UTSW 15 101625811 missense probably damaging 1.00
R6781:Gm5414 UTSW 15 101625661 missense possibly damaging 0.91
R8298:Gm5414 UTSW 15 101624170 missense unknown
RF001:Gm5414 UTSW 15 101627953 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGAGTTTCTTGAAGGGACC -3'
(R):5'- TCACCAGAAACCATGGTCTG -3'

Sequencing Primer
(F):5'- AAGGGACCATTATGGCTAGTGCTC -3'
(R):5'- GAGATGCACACTCCACGATTG -3'
Posted On2015-06-20