Incidental Mutation 'R4257:Gm6563'
ID321878
Institutional Source Beutler Lab
Gene Symbol Gm6563
Ensembl Gene ENSMUSG00000051255
Gene Namepredicted pseudogene 6563
Synonyms
MMRRC Submission 041070-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.902) question?
Stock #R4257 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23675844-23676712 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23675975 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 43 (E43G)
Ref Sequence ENSEMBL: ENSMUSP00000137244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056396]
Predicted Effect possibly damaging
Transcript: ENSMUST00000056396
AA Change: E43G

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000137244
Gene: ENSMUSG00000051255
AA Change: E43G

DomainStartEndE-ValueType
SAP 8 42 2.49e-10 SMART
low complexity region 43 80 N/A INTRINSIC
internal_repeat_1 117 130 5.45e-5 PROSPERO
low complexity region 165 180 N/A INTRINSIC
internal_repeat_1 197 210 5.45e-5 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930451I11Rik C T 7: 126,831,490 probably benign Het
4930578I06Rik C T 14: 63,973,209 R190H probably benign Het
Akap13 T A 7: 75,611,285 I1219K probably damaging Het
Arfgef1 T C 1: 10,159,546 probably benign Het
Arhgap24 A G 5: 102,664,117 E70G probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Babam2 T C 5: 31,702,070 S40P possibly damaging Het
Brwd1 A G 16: 96,023,496 V1190A probably damaging Het
Ccpg1 A G 9: 73,012,627 E508G probably damaging Het
Ckm T C 7: 19,421,354 S372P probably benign Het
Egflam T A 15: 7,254,426 probably null Het
Farp1 G A 14: 121,255,479 V498M probably benign Het
Galnt14 T A 17: 73,504,904 I441F probably benign Het
Gm5414 A G 15: 101,624,672 L440P probably damaging Het
Gm9755 A T 8: 67,514,477 noncoding transcript Het
Gmds A G 13: 31,820,189 S337P possibly damaging Het
L3mbtl3 T A 10: 26,280,122 Q754L unknown Het
Ltk G A 2: 119,753,004 T300I possibly damaging Het
Olfr1176 A C 2: 88,340,277 K237N probably damaging Het
Pbx2 C A 17: 34,594,645 H184Q probably damaging Het
Plxna2 T C 1: 194,644,775 F339S probably damaging Het
Prkaa2 A T 4: 105,039,956 D353E probably benign Het
Prss36 G A 7: 127,932,838 probably benign Het
Rimbp2 A G 5: 128,774,260 V874A probably damaging Het
Rspo2 C A 15: 43,075,911 R161L probably benign Het
Ryr1 T C 7: 29,082,450 D2038G possibly damaging Het
Stkld1 A G 2: 26,943,134 M111V probably benign Het
Tprn A G 2: 25,264,482 I599V probably damaging Het
Upp2 A T 2: 58,780,094 I219F probably damaging Het
Vmn2r94 A T 17: 18,244,171 F619Y probably damaging Het
Xirp2 A G 2: 67,516,039 T2875A probably benign Het
Zfp64 A G 2: 168,926,378 L438P probably damaging Het
Other mutations in Gm6563
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Gm6563 APN 19 23676387 missense probably damaging 0.99
IGL02247:Gm6563 APN 19 23676028 missense possibly damaging 0.73
IGL02989:Gm6563 APN 19 23675870 missense possibly damaging 0.82
R1274:Gm6563 UTSW 19 23676337 missense probably benign 0.14
R6048:Gm6563 UTSW 19 23675882 missense probably benign 0.00
R8518:Gm6563 UTSW 19 23676116 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGTTGCTGATTGAATACCCATC -3'
(R):5'- ACATTGAATCGTTCAGCCCTC -3'

Sequencing Primer
(F):5'- AAGCTGATCTGGACCATGTGACTC -3'
(R):5'- CATTCTTTCAGTCTGAGGTATTCCAG -3'
Posted On2015-06-20