Incidental Mutation 'R4258:Traf3ip3'
ID321882
Institutional Source Beutler Lab
Gene Symbol Traf3ip3
Ensembl Gene ENSMUSG00000037318
Gene NameTRAF3 interacting protein 3
Synonyms6030423D04Rik
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location193175453-193201703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 193197946 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 25 (R25Q)
Ref Sequence ENSEMBL: ENSMUSP00000141698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043550] [ENSMUST00000161367] [ENSMUST00000192020] [ENSMUST00000194278]
Predicted Effect probably damaging
Transcript: ENSMUST00000043550
AA Change: R25Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040977
Gene: ENSMUSG00000037318
AA Change: R25Q

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161151
Predicted Effect probably damaging
Transcript: ENSMUST00000161367
AA Change: R9Q

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000141358
Gene: ENSMUSG00000037318
AA Change: R9Q

DomainStartEndE-ValueType
low complexity region 7 28 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161403
Predicted Effect probably benign
Transcript: ENSMUST00000162480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162905
Predicted Effect probably damaging
Transcript: ENSMUST00000192020
AA Change: R25Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141698
Gene: ENSMUSG00000037318
AA Change: R25Q

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000194278
AA Change: R25Q

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000141661
Gene: ENSMUSG00000037318
AA Change: R25Q

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired single positive thymocyte development and increased gamma-delta T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Traf3ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Traf3ip3 APN 1 193194820 intron probably benign
IGL00663:Traf3ip3 APN 1 193187138 missense probably damaging 1.00
IGL01125:Traf3ip3 APN 1 193184464 splice site probably null
IGL01308:Traf3ip3 APN 1 193184891 missense probably damaging 1.00
IGL01608:Traf3ip3 APN 1 193187110 missense probably benign 0.00
IGL02225:Traf3ip3 APN 1 193195100 missense probably benign 0.03
IGL02432:Traf3ip3 APN 1 193184576 missense probably damaging 1.00
IGL03102:Traf3ip3 APN 1 193195077 missense probably damaging 1.00
IGL03179:Traf3ip3 APN 1 193194368 missense probably damaging 1.00
IGL02988:Traf3ip3 UTSW 1 193194874 unclassified probably null
R0110:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0469:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0510:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0529:Traf3ip3 UTSW 1 193194811 intron probably benign
R1165:Traf3ip3 UTSW 1 193184478 missense probably damaging 0.99
R1559:Traf3ip3 UTSW 1 193178291 missense probably damaging 0.99
R1729:Traf3ip3 UTSW 1 193181893 missense probably benign 0.01
R1896:Traf3ip3 UTSW 1 193175734 missense probably benign
R4085:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4086:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4087:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4088:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4090:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4817:Traf3ip3 UTSW 1 193184829 missense probably damaging 1.00
R5299:Traf3ip3 UTSW 1 193178175 nonsense probably null
R5906:Traf3ip3 UTSW 1 193198006 missense possibly damaging 0.55
R6268:Traf3ip3 UTSW 1 193198036 start gained probably benign
R6374:Traf3ip3 UTSW 1 193182010 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- ATAGACACTTGGCCTGTTCC -3'
(R):5'- AGACTGTCAGTTTTCAACCCATC -3'

Sequencing Primer
(F):5'- CTCCATCTGTCTTGCTGGAGG -3'
(R):5'- GTCAGTTTTCAACCCATCTTCTGAC -3'
Posted On2015-06-20