Incidental Mutation 'R4258:Mtf1'
ID321893
Institutional Source Beutler Lab
Gene Symbol Mtf1
Ensembl Gene ENSMUSG00000028890
Gene Namemetal response element binding transcription factor 1
SynonymsThyls, metalloregulatory transcription factor, MTF-1, metal response element-binding transcription factor 1
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124802104-124849800 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 124838783 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 545 (T545A)
Ref Sequence ENSEMBL: ENSMUSP00000101799 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030723] [ENSMUST00000106193]
Predicted Effect probably benign
Transcript: ENSMUST00000030723
AA Change: T545A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000030723
Gene: ENSMUSG00000028890
AA Change: T545A

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106193
AA Change: T545A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101799
Gene: ENSMUSG00000028890
AA Change: T545A

DomainStartEndE-ValueType
ZnF_C2H2 139 163 1.22e-4 SMART
ZnF_C2H2 169 193 6.42e-4 SMART
ZnF_C2H2 199 223 2.4e-3 SMART
ZnF_C2H2 228 252 2.57e-3 SMART
ZnF_C2H2 258 282 2.57e-3 SMART
ZnF_C2H2 288 312 7.37e-4 SMART
low complexity region 429 456 N/A INTRINSIC
low complexity region 500 526 N/A INTRINSIC
low complexity region 545 558 N/A INTRINSIC
low complexity region 628 638 N/A INTRINSIC
low complexity region 656 669 N/A INTRINSIC
Meta Mutation Damage Score 0.0582 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that induces expression of metallothioneins and other genes involved in metal homeostasis in response to heavy metals such as cadmium, zinc, copper, and silver. The protein is a nucleocytoplasmic shuttling protein that accumulates in the nucleus upon heavy metal exposure and binds to promoters containing a metal-responsive element (MRE). [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation show impaired hepatocyte development followed by embryonic liver degeneration, generalized edema, and death at ~14 days of gestation. Mutant embryonic fibroblasts show increased susceptibility to the cytotoxiceffects of cadmium and hydrogen peroxide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Mtf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01902:Mtf1 APN 4 124804927 missense probably damaging 0.99
IGL02491:Mtf1 APN 4 124838579 missense probably benign 0.00
IGL02493:Mtf1 APN 4 124821319 missense probably damaging 1.00
IGL02644:Mtf1 APN 4 124820235 missense probably damaging 1.00
IGL02661:Mtf1 APN 4 124825109 missense probably damaging 0.98
IGL03018:Mtf1 APN 4 124838663 missense probably benign 0.44
LCD18:Mtf1 UTSW 4 124829316 intron probably benign
R0443:Mtf1 UTSW 4 124824282 unclassified probably benign
R0599:Mtf1 UTSW 4 124820201 splice site probably benign
R1103:Mtf1 UTSW 4 124838468 missense probably benign 0.28
R2496:Mtf1 UTSW 4 124838904 missense probably benign 0.01
R4818:Mtf1 UTSW 4 124804712 start codon destroyed probably null 1.00
R5085:Mtf1 UTSW 4 124821308 missense probably damaging 1.00
R5248:Mtf1 UTSW 4 124820427 missense probably damaging 1.00
R5368:Mtf1 UTSW 4 124825079 missense probably damaging 0.98
R6368:Mtf1 UTSW 4 124824352 missense probably damaging 1.00
R6768:Mtf1 UTSW 4 124837785 missense probably benign 0.01
R7417:Mtf1 UTSW 4 124825181 missense probably null 0.00
R7559:Mtf1 UTSW 4 124820206 missense probably damaging 1.00
R7730:Mtf1 UTSW 4 124838619 missense possibly damaging 0.49
R7739:Mtf1 UTSW 4 124824288 missense probably damaging 1.00
X0018:Mtf1 UTSW 4 124838847 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TCCCCACAGCACACAGTTTG -3'
(R):5'- CTATATTGCATGTCACCCTACTGG -3'

Sequencing Primer
(F):5'- AGCACACAGTTTGCTGCTAATC -3'
(R):5'- CTGGGTGTGCTTACAAGTAATAC -3'
Posted On2015-06-20