Mutagenetix > Incidental Mutations

Incidental Mutation 'R4258:Brdt'

321896

Institutional Source

Beutler Lab

Gene Symbol

Brdt

Ensembl Gene

ENSMUSG00000029279

Gene Name

bromodomain, testis-specific

Synonyms

Fsrg3, 7420412D09Rik, Brd6

MMRRC Submission

041071-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4258 (G1)

Quality Score

123

Status

Not validated

Chromosome

Chromosomal Location

107331159-107387058 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107359909 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 668 (S668G)

Ref Sequence

ENSEMBL: ENSMUSP00000031215 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031215]

AlphaFold

Q91Y44

PDB Structure

Structure of Brdt bromodomain 2 bound to an acetylated histone H3 peptide [X-RAY DIFFRACTION]
Structure of Brdt bromodomain BD1 bound to a diacetylated histone H4 peptide. [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000031215
AA Change: S668G

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000031215
Gene: ENSMUSG00000029279
AA Change: S668G

Domain	Start	End	E-Value	Type
BROMO	24	134	2.7e-45	SMART
BROMO	268	377	2.18e-40	SMART
low complexity region	392	417	N/A	INTRINSIC
low complexity region	446	455	N/A	INTRINSIC
low complexity region	472	500	N/A	INTRINSIC
Pfam:BET	505	569	9.2e-34	PFAM
low complexity region	585	603	N/A	INTRINSIC
low complexity region	649	691	N/A	INTRINSIC
low complexity region	895	909	N/A	INTRINSIC
Pfam:BRD4_CDT	913	956	3e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162804

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (60/63)

MGI Phenotype

FUNCTION: The protein encoded by this gene belongs to the BET protein family. BET proteins have two N-terminal bromodomains and one C-terminal extraterminal domain (ET domain). BET proteins regulate chromatin reorganization via binding to acetylated histones. This gene is thought to play a role in the transcriptional regulation of spermatogenesis. Although referred to as testis-specific bromodomain (Brdt) protein, RT-PCR indicates that this gene is expressed in both mouse oocytes and testes. Alternative splicing results in multiple transcript variants encoding different proteins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this genes leads to arrest of spermatogenesis and male infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	T	C	9: 105,143,568	I165V	probably damaging	Het
4932415M13Rik	T	A	17: 53,724,413		noncoding transcript	Het
Ank3	T	C	10: 70,004,762	I984T	probably benign	Het
Arnt2	T	C	7: 84,310,955	T204A	probably damaging	Het
Arsi	T	C	18: 60,917,316	W424R	probably damaging	Het
Aspg	A	T	12: 112,121,253	N346I	probably benign	Het
Ccdc178	C	T	18: 22,017,335		probably null	Het
Cfap58	A	T	19: 47,949,484		probably null	Het
Chaf1a	C	A	17: 56,056,474	H319Q	unknown	Het
Colec12	T	C	18: 9,720,950	S13P	probably damaging	Het
Cpne9	C	T	6: 113,283,023		probably benign	Het
Cyp2c65	A	C	19: 39,093,428	D466A	probably benign	Het
Cyp3a25	T	C	5: 145,991,438	K266E	probably damaging	Het
Dennd1b	G	T	1: 139,062,940	R214L	probably damaging	Het
Dock9	T	C	14: 121,581,442	I1533V	probably benign	Het
Dynlt1a	C	T	17: 6,310,909	M102I	probably benign	Het
Edil3	G	T	13: 89,177,153	L220F	probably damaging	Het
Eml5	A	G	12: 98,865,434	Y383H	probably benign	Het
Epc1	T	A	18: 6,450,130	T393S	probably benign	Het
Fbxo8	A	T	8: 56,588,041	D164V	probably benign	Het
Gbp4	T	A	5: 105,136,975	N16I	probably damaging	Het
Gdf6	G	A	4: 9,844,877	V134I	probably damaging	Het
Gm21876	C	T	X: 21,174,928	S45N	probably damaging	Het
Gm5475	A	G	15: 100,424,236		probably benign	Het
Gm6430	T	G	1: 97,024,836		noncoding transcript	Het
Ighv9-4	A	T	12: 114,300,145	V56E	probably damaging	Het
Il3ra	A	T	14: 14,347,961	N36Y	probably damaging	Het
Kif7	G	T	7: 79,710,513	C325*	probably null	Het
Lipo2	A	T	19: 33,730,928	F229I	possibly damaging	Het
Lrba	A	G	3: 86,445,349	K1935E	probably damaging	Het
Mki67	A	T	7: 135,695,288	D2672E	possibly damaging	Het
Mtf1	A	G	4: 124,838,783	T545A	probably benign	Het
Mup6	A	T	4: 60,004,812		probably null	Het
Myo9b	T	C	8: 71,355,765	V1672A	probably damaging	Het
Olfr1164	T	A	2: 88,093,018	N306I	probably damaging	Het
Olfr122	C	A	17: 37,772,058	P135Q	probably damaging	Het
Olfr1280	A	T	2: 111,315,638	H53L	probably benign	Het
Olfr16	C	T	1: 172,957,638	T281I	possibly damaging	Het
Pcdhgb2	A	T	18: 37,692,049	I698F	probably damaging	Het
Pkn3	C	T	2: 30,088,560	H665Y	probably damaging	Het
Ppil6	T	A	10: 41,507,535	L99*	probably null	Het
Psg22	T	A	7: 18,724,629	V376E	probably damaging	Het
Pum1	G	A	4: 130,730,280	R201H	probably damaging	Het
Rasa2	A	T	9: 96,557,380		probably benign	Het
Schip1	T	A	3: 68,618,630	M379K	possibly damaging	Het
Scn9a	A	T	2: 66,565,054		probably benign	Het
Sh3tc1	C	T	5: 35,706,978	A622T	probably benign	Het
Smarcd2	A	T	11: 106,265,250	I292N	probably damaging	Het
Stab1	G	A	14: 31,154,672	R862C	possibly damaging	Het
Tdrd5	T	A	1: 156,259,742	H870L	probably benign	Het
Tnfaip8	A	G	18: 50,090,376	R60G	possibly damaging	Het
Traf3ip3	C	T	1: 193,197,946	R25Q	probably damaging	Het
Unc5b	T	C	10: 60,765,371	Y892C	probably damaging	Het
Vmn2r2	T	G	3: 64,134,697	D199A	probably damaging	Het
Washc2	C	A	6: 116,208,241	P12Q	probably damaging	Het
Zfp286	T	C	11: 62,781,070	I121V	probably benign	Het
Zfp606	T	A	7: 12,494,340		probably null	Het

Other mutations in Brdt

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02342:Brdt	APN	5	107342203	missense	probably damaging	1.00
IGL02718:Brdt	APN	5	107350068	splice site	probably benign
IGL02746:Brdt	APN	5	107370324	missense	probably benign
IGL02851:Brdt	APN	5	107377995	missense	possibly damaging	0.47
R0585:Brdt	UTSW	5	107356882	critical splice donor site	probably null
R0708:Brdt	UTSW	5	107358900	nonsense	probably null
R1338:Brdt	UTSW	5	107350188	missense	probably benign	0.02
R1710:Brdt	UTSW	5	107343584	missense	probably damaging	1.00
R1794:Brdt	UTSW	5	107359853	small deletion	probably benign
R1861:Brdt	UTSW	5	107359458	missense	probably benign
R1913:Brdt	UTSW	5	107348613	missense	probably benign
R2029:Brdt	UTSW	5	107359224	missense	probably benign	0.35
R2431:Brdt	UTSW	5	107378015	splice site	probably null
R3121:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R3122:Brdt	UTSW	5	107377145	missense	probably damaging	0.99
R4609:Brdt	UTSW	5	107359936	missense	probably benign	0.00
R5306:Brdt	UTSW	5	107345144	missense	probably damaging	1.00
R5640:Brdt	UTSW	5	107359308	nonsense	probably null
R5677:Brdt	UTSW	5	107348617	missense	possibly damaging	0.85
R5936:Brdt	UTSW	5	107359395	missense	probably damaging	1.00
R6145:Brdt	UTSW	5	107377999	missense	possibly damaging	0.67
R6261:Brdt	UTSW	5	107348503	missense	probably benign	0.04
R6408:Brdt	UTSW	5	107385492	missense	probably damaging	1.00
R6930:Brdt	UTSW	5	107359215	missense	probably benign	0.35
R7372:Brdt	UTSW	5	107370294	missense	possibly damaging	0.49
R7741:Brdt	UTSW	5	107358886	missense	probably benign	0.00
R7842:Brdt	UTSW	5	107348588	missense	possibly damaging	0.49
R7869:Brdt	UTSW	5	107370179	missense	probably benign	0.04
R7887:Brdt	UTSW	5	107359933	missense	possibly damaging	0.66
R7972:Brdt	UTSW	5	107348549	missense	possibly damaging	0.53
R8064:Brdt	UTSW	5	107377996	nonsense	probably null
R8958:Brdt	UTSW	5	107378011	missense	probably benign
R9199:Brdt	UTSW	5	107350163	nonsense	probably null
R9346:Brdt	UTSW	5	107377014	missense	probably damaging	0.99
X0011:Brdt	UTSW	5	107342128	missense	probably damaging	0.96
X0011:Brdt	UTSW	5	107377092	missense	probably damaging	1.00
Z1176:Brdt	UTSW	5	107359898	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- CAAAAGGTAGGTGGCGGTTTC -3'
(R):5'- GATGTTGGCATCCAAAGCATAG -3'

Sequencing Primer
(F):5'- CCACCCGTGAGCCATGAC -3'
(R):5'- TTGGCATCCAAAGCATAGGTCCTC -3'

Posted On

2015-06-20