Incidental Mutation 'R4258:Cpne9'
ID321897
Institutional Source Beutler Lab
Gene Symbol Cpne9
Ensembl Gene ENSMUSG00000030270
Gene Namecopine family member IX
Synonyms
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113282307-113305627 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 113283023 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000041203] [ENSMUST00000113146] [ENSMUST00000129883] [ENSMUST00000130191] [ENSMUST00000134945]
Predicted Effect probably benign
Transcript: ENSMUST00000041203
SMART Domains Protein: ENSMUSP00000044416
Gene: ENSMUSG00000030270

DomainStartEndE-ValueType
C2 14 122 2.12e-10 SMART
C2 143 257 5.15e-9 SMART
VWA 297 495 4.4e-10 SMART
low complexity region 536 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113146
SMART Domains Protein: ENSMUSP00000108771
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Blast:C2 605 647 2e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124574
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128148
Predicted Effect probably benign
Transcript: ENSMUST00000129883
SMART Domains Protein: ENSMUSP00000114575
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000130191
AA Change: P44L
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132372
Predicted Effect probably benign
Transcript: ENSMUST00000134945
SMART Domains Protein: ENSMUSP00000118001
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Blast:C2 221 256 3e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138388
Predicted Effect probably benign
Transcript: ENSMUST00000148523
SMART Domains Protein: ENSMUSP00000115808
Gene: ENSMUSG00000030269

DomainStartEndE-ValueType
Pfam:Myotub-related 1 102 4.2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155779
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204050
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Cpne9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Cpne9 APN 6 113293022 missense possibly damaging 0.54
IGL02318:Cpne9 APN 6 113293738 missense possibly damaging 0.74
IGL02800:Cpne9 APN 6 113302073 missense probably benign 0.40
IGL02819:Cpne9 APN 6 113300663 missense probably damaging 0.99
IGL03111:Cpne9 APN 6 113300610 missense possibly damaging 0.79
PIT4366001:Cpne9 UTSW 6 113294746 missense probably damaging 1.00
R0145:Cpne9 UTSW 6 113300601 missense probably damaging 0.97
R0319:Cpne9 UTSW 6 113294693 missense probably damaging 1.00
R0514:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R0586:Cpne9 UTSW 6 113295063 missense probably damaging 0.96
R0594:Cpne9 UTSW 6 113290400 splice site probably benign
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R1464:Cpne9 UTSW 6 113294737 missense probably damaging 1.00
R4184:Cpne9 UTSW 6 113282457 unclassified probably benign
R4243:Cpne9 UTSW 6 113283023 unclassified probably benign
R4256:Cpne9 UTSW 6 113283023 unclassified probably benign
R4412:Cpne9 UTSW 6 113290001 missense possibly damaging 0.78
R4690:Cpne9 UTSW 6 113302055 missense probably damaging 1.00
R5062:Cpne9 UTSW 6 113304488 missense probably damaging 0.99
R5249:Cpne9 UTSW 6 113293073 splice site probably benign
R5437:Cpne9 UTSW 6 113304630 unclassified probably benign
R5523:Cpne9 UTSW 6 113290231 missense probably damaging 1.00
R5979:Cpne9 UTSW 6 113293749 missense probably benign 0.44
R6207:Cpne9 UTSW 6 113294773 missense possibly damaging 0.88
R6849:Cpne9 UTSW 6 113302118 missense probably damaging 0.98
R6989:Cpne9 UTSW 6 113300583 missense possibly damaging 0.95
R7376:Cpne9 UTSW 6 113290013 missense probably damaging 0.98
R7524:Cpne9 UTSW 6 113302064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACATATAGAGCCATTTGTCAG -3'
(R):5'- GTCAATCACCTCGGTTCGTC -3'

Sequencing Primer
(F):5'- AGAGCCATTTGTCAGAGATGTC -3'
(R):5'- TCTGCGTGTGAAGCACCAC -3'
Posted On2015-06-20