Mutagenetix > Incidental Mutations

Incidental Mutation 'R4258:Eml5'

321913

Institutional Source

Beutler Lab

Gene Symbol

Eml5

Ensembl Gene

ENSMUSG00000051166

Gene Name

echinoderm microtubule associated protein like 5

Synonyms

C130068M19Rik

MMRRC Submission

041071-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.339) question?

Stock #

R4258 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98786805-98901484 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 98865434 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 383 (Y383H)

Ref Sequence

ENSEMBL: ENSMUSP00000065643 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065716] [ENSMUST00000223282]

Predicted Effect

probably benign
Transcript: ENSMUST00000065716
AA Change: Y383H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)

SMART Domains

Protein: ENSMUSP00000065643
Gene: ENSMUSG00000051166
AA Change: Y383H

Domain	Start	End	E-Value	Type
Pfam:HELP	1	49	3.3e-21	PFAM
WD40	50	91	6.42e-1	SMART
WD40	94	136	1.08e-4	SMART
WD40	139	178	1.27e-1	SMART
WD40	184	224	2.75e1	SMART
WD40	225	263	2.65e-4	SMART
Blast:WD40	265	312	2e-22	BLAST
WD40	313	353	4.69e-5	SMART
WD40	356	394	2.2e2	SMART
WD40	397	436	8.59e-1	SMART
WD40	444	479	6.6e1	SMART
WD40	505	546	2.74e2	SMART
WD40	552	592	4.8e-2	SMART
low complexity region	609	632	N/A	INTRINSIC
Pfam:HELP	656	715	1.4e-20	PFAM
WD40	716	757	1.18e-1	SMART
WD40	760	802	2.84e-4	SMART
WD40	805	844	1.91e1	SMART
WD40	853	891	2.64e2	SMART
WD40	892	929	3.45e-3	SMART
WD40	985	1026	4.55e-3	SMART
WD40	1029	1068	6.39e0	SMART
WD40	1071	1111	5.15e-2	SMART
WD40	1180	1221	1.9e2	SMART
WD40	1227	1267	1.38e0	SMART
low complexity region	1280	1297	N/A	INTRINSIC
Pfam:HELP	1335	1410	2.4e-16	PFAM
Blast:WD40	1412	1462	8e-28	BLAST
WD40	1465	1507	1.56e-1	SMART
WD40	1510	1549	2.06e0	SMART
WD40	1558	1597	8.22e1	SMART
WD40	1599	1644	4.26e1	SMART
WD40	1690	1730	2.19e-5	SMART
WD40	1774	1813	5.97e-1	SMART
WD40	1884	1925	2.39e0	SMART
WD40	1931	1971	2.88e-1	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223282
AA Change: Y422H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Meta Mutation Damage Score

0.0603

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (60/63)

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700080E11Rik	T	C	9: 105,143,568	I165V	probably damaging	Het
4932415M13Rik	T	A	17: 53,724,413		noncoding transcript	Het
Ank3	T	C	10: 70,004,762	I984T	probably benign	Het
Arnt2	T	C	7: 84,310,955	T204A	probably damaging	Het
Arsi	T	C	18: 60,917,316	W424R	probably damaging	Het
Aspg	A	T	12: 112,121,253	N346I	probably benign	Het
Brdt	A	G	5: 107,359,909	S668G	probably damaging	Het
Ccdc178	C	T	18: 22,017,335		probably null	Het
Cfap58	A	T	19: 47,949,484		probably null	Het
Chaf1a	C	A	17: 56,056,474	H319Q	unknown	Het
Colec12	T	C	18: 9,720,950	S13P	probably damaging	Het
Cpne9	C	T	6: 113,283,023		probably benign	Het
Cyp2c65	A	C	19: 39,093,428	D466A	probably benign	Het
Cyp3a25	T	C	5: 145,991,438	K266E	probably damaging	Het
Dennd1b	G	T	1: 139,062,940	R214L	probably damaging	Het
Dock9	T	C	14: 121,581,442	I1533V	probably benign	Het
Dynlt1a	C	T	17: 6,310,909	M102I	probably benign	Het
Edil3	G	T	13: 89,177,153	L220F	probably damaging	Het
Epc1	T	A	18: 6,450,130	T393S	probably benign	Het
Fbxo8	A	T	8: 56,588,041	D164V	probably benign	Het
Gbp4	T	A	5: 105,136,975	N16I	probably damaging	Het
Gdf6	G	A	4: 9,844,877	V134I	probably damaging	Het
Gm21876	C	T	X: 21,174,928	S45N	probably damaging	Het
Gm5475	A	G	15: 100,424,236		probably benign	Het
Gm6430	T	G	1: 97,024,836		noncoding transcript	Het
Ighv9-4	A	T	12: 114,300,145	V56E	probably damaging	Het
Il3ra	A	T	14: 14,347,961	N36Y	probably damaging	Het
Kif7	G	T	7: 79,710,513	C325*	probably null	Het
Lipo2	A	T	19: 33,730,928	F229I	possibly damaging	Het
Lrba	A	G	3: 86,445,349	K1935E	probably damaging	Het
Mki67	A	T	7: 135,695,288	D2672E	possibly damaging	Het
Mtf1	A	G	4: 124,838,783	T545A	probably benign	Het
Mup6	A	T	4: 60,004,812		probably null	Het
Myo9b	T	C	8: 71,355,765	V1672A	probably damaging	Het
Olfr1164	T	A	2: 88,093,018	N306I	probably damaging	Het
Olfr122	C	A	17: 37,772,058	P135Q	probably damaging	Het
Olfr1280	A	T	2: 111,315,638	H53L	probably benign	Het
Olfr16	C	T	1: 172,957,638	T281I	possibly damaging	Het
Pcdhgb2	A	T	18: 37,692,049	I698F	probably damaging	Het
Pkn3	C	T	2: 30,088,560	H665Y	probably damaging	Het
Ppil6	T	A	10: 41,507,535	L99*	probably null	Het
Psg22	T	A	7: 18,724,629	V376E	probably damaging	Het
Pum1	G	A	4: 130,730,280	R201H	probably damaging	Het
Rasa2	A	T	9: 96,557,380		probably benign	Het
Schip1	T	A	3: 68,618,630	M379K	possibly damaging	Het
Scn9a	A	T	2: 66,565,054		probably benign	Het
Sh3tc1	C	T	5: 35,706,978	A622T	probably benign	Het
Smarcd2	A	T	11: 106,265,250	I292N	probably damaging	Het
Stab1	G	A	14: 31,154,672	R862C	possibly damaging	Het
Tdrd5	T	A	1: 156,259,742	H870L	probably benign	Het
Tnfaip8	A	G	18: 50,090,376	R60G	possibly damaging	Het
Traf3ip3	C	T	1: 193,197,946	R25Q	probably damaging	Het
Unc5b	T	C	10: 60,765,371	Y892C	probably damaging	Het
Vmn2r2	T	G	3: 64,134,697	D199A	probably damaging	Het
Washc2	C	A	6: 116,208,241	P12Q	probably damaging	Het
Zfp286	T	C	11: 62,781,070	I121V	probably benign	Het
Zfp606	T	A	7: 12,494,340		probably null	Het

Other mutations in Eml5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00091:Eml5	APN	12	98873209	splice site	probably benign
IGL00473:Eml5	APN	12	98805492	splice site	probably benign
IGL01120:Eml5	APN	12	98844019	missense	probably benign
IGL01308:Eml5	APN	12	98802313	missense	probably damaging	1.00
IGL01790:Eml5	APN	12	98798932	missense	probably damaging	1.00
IGL01973:Eml5	APN	12	98863280	missense	probably benign
IGL02182:Eml5	APN	12	98802322	missense	probably damaging	1.00
IGL02201:Eml5	APN	12	98794424	splice site	probably benign
IGL02375:Eml5	APN	12	98844087	missense	probably damaging	1.00
IGL02397:Eml5	APN	12	98790674	missense	probably benign	0.07
IGL02480:Eml5	APN	12	98876243	missense	probably damaging	1.00
IGL02801:Eml5	APN	12	98817845	missense	possibly damaging	0.88
IGL02876:Eml5	APN	12	98858841	missense	probably damaging	1.00
IGL03104:Eml5	APN	12	98861245	nonsense	probably null
IGL03158:Eml5	APN	12	98827514	splice site	probably benign
IGL03286:Eml5	APN	12	98860503	missense	probably damaging	1.00
IGL03380:Eml5	APN	12	98874647	splice site	probably benign
BB010:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
BB020:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R0573:Eml5	UTSW	12	98824772	splice site	probably null
R0624:Eml5	UTSW	12	98865479	missense	probably damaging	1.00
R0993:Eml5	UTSW	12	98861183	missense	probably benign	0.25
R1073:Eml5	UTSW	12	98830973	missense	probably damaging	1.00
R1183:Eml5	UTSW	12	98792046	missense	probably benign	0.31
R1352:Eml5	UTSW	12	98831003	splice site	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1469:Eml5	UTSW	12	98858823	missense	probably benign
R1503:Eml5	UTSW	12	98831174	missense	probably damaging	0.99
R1538:Eml5	UTSW	12	98794276	missense	probably damaging	0.99
R1689:Eml5	UTSW	12	98830935	missense	probably damaging	1.00
R1773:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1775:Eml5	UTSW	12	98852704	splice site	probably null
R1791:Eml5	UTSW	12	98887056	missense	probably benign	0.31
R1856:Eml5	UTSW	12	98810584	missense	probably damaging	1.00
R1919:Eml5	UTSW	12	98798839	missense	probably damaging	1.00
R1957:Eml5	UTSW	12	98859961	missense	probably damaging	1.00
R1962:Eml5	UTSW	12	98876311	missense	probably damaging	0.99
R2033:Eml5	UTSW	12	98791386	missense	possibly damaging	0.71
R2035:Eml5	UTSW	12	98794266	missense	probably benign	0.33
R2073:Eml5	UTSW	12	98802446	missense	probably damaging	0.99
R2143:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2144:Eml5	UTSW	12	98810605	missense	probably damaging	1.00
R2158:Eml5	UTSW	12	98843946	splice site	probably benign
R2164:Eml5	UTSW	12	98887097	missense	probably damaging	0.99
R2175:Eml5	UTSW	12	98876223	nonsense	probably null
R2200:Eml5	UTSW	12	98825417	missense	probably damaging	1.00
R2234:Eml5	UTSW	12	98841581	missense	probably damaging	1.00
R2504:Eml5	UTSW	12	98844105	missense	possibly damaging	0.71
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2871:Eml5	UTSW	12	98865401	missense	probably damaging	1.00
R2958:Eml5	UTSW	12	98876178	missense	possibly damaging	0.74
R3013:Eml5	UTSW	12	98880808	splice site	probably null
R3118:Eml5	UTSW	12	98865494	missense	probably damaging	0.97
R3735:Eml5	UTSW	12	98855989	missense	possibly damaging	0.78
R3856:Eml5	UTSW	12	98816024	missense	probably damaging	1.00
R3900:Eml5	UTSW	12	98825523	missense	probably damaging	1.00
R3973:Eml5	UTSW	12	98802465	splice site	probably benign
R3976:Eml5	UTSW	12	98802465	splice site	probably benign
R4105:Eml5	UTSW	12	98841548	splice site	probably null
R4107:Eml5	UTSW	12	98841548	splice site	probably null
R4108:Eml5	UTSW	12	98841548	splice site	probably null
R4109:Eml5	UTSW	12	98841548	splice site	probably null
R4381:Eml5	UTSW	12	98815955	missense	possibly damaging	0.93
R4590:Eml5	UTSW	12	98837341	missense	possibly damaging	0.91
R4737:Eml5	UTSW	12	98798852	missense	probably damaging	1.00
R4775:Eml5	UTSW	12	98802307	missense	probably benign	0.05
R4850:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5007:Eml5	UTSW	12	98830965	missense	probably damaging	1.00
R5092:Eml5	UTSW	12	98792616	missense	probably damaging	1.00
R5123:Eml5	UTSW	12	98874512	missense	probably damaging	1.00
R5124:Eml5	UTSW	12	98792042	missense	probably damaging	1.00
R5273:Eml5	UTSW	12	98790688	missense	probably damaging	1.00
R5369:Eml5	UTSW	12	98858783	missense	probably damaging	1.00
R5430:Eml5	UTSW	12	98794158	missense	probably damaging	1.00
R5748:Eml5	UTSW	12	98825555	missense	probably damaging	0.99
R5769:Eml5	UTSW	12	98790619	missense	probably damaging	1.00
R5832:Eml5	UTSW	12	98876188	missense	probably benign
R6113:Eml5	UTSW	12	98824674	nonsense	probably null
R6131:Eml5	UTSW	12	98861251	missense	probably damaging	0.99
R6175:Eml5	UTSW	12	98794456	missense	possibly damaging	0.69
R6184:Eml5	UTSW	12	98863129	missense	possibly damaging	0.53
R6357:Eml5	UTSW	12	98870884	missense	probably damaging	0.98
R6375:Eml5	UTSW	12	98798868
R6528:Eml5	UTSW	12	98824637	missense	probably benign	0.18
R6657:Eml5	UTSW	12	98791405	missense	probably damaging	0.98
R6717:Eml5	UTSW	12	98827506	missense	probably damaging	1.00
R6751:Eml5	UTSW	12	98865400	missense	probably damaging	1.00
R6833:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6834:Eml5	UTSW	12	98887024	missense	probably damaging	1.00
R6972:Eml5	UTSW	12	98876180	missense	probably benign	0.00
R7091:Eml5	UTSW	12	98802474	missense	probably benign	0.16
R7353:Eml5	UTSW	12	98825424	missense
R7644:Eml5	UTSW	12	98855944	missense	probably benign	0.05
R7694:Eml5	UTSW	12	98792563	missense	probably damaging	0.99
R7842:Eml5	UTSW	12	98794135	missense	probably damaging	1.00
R7933:Eml5	UTSW	12	98844020	missense	possibly damaging	0.87
R8111:Eml5	UTSW	12	98792514	critical splice donor site	probably null
R8198:Eml5	UTSW	12	98858886	nonsense	probably null
R8482:Eml5	UTSW	12	98876301	missense	probably damaging	1.00
T0722:Eml5	UTSW	12	98841582	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAGTCGCTTTCCACTGC -3'
(R):5'- TGAGCTAGTTCAGGCACCATG -3'

Sequencing Primer
(F):5'- CACTGCCATCATTTGTCTGTAAG -3'
(R):5'- CAGGCACCATGGTCTTTTCTATAAG -3'

Posted On

2015-06-20