Incidental Mutation 'R4258:Ighv9-4'
ID 321915
Institutional Source Beutler Lab
Gene Symbol Ighv9-4
Ensembl Gene ENSMUSG00000094322
Gene Name immunoglobulin heavy variable 9-4
Synonyms Gm7175
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock # R4258 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 114299961-114300389 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 114300145 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 56 (V56E)
Ref Sequence ENSEMBL: ENSMUSP00000141555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103482] [ENSMUST00000194159]
AlphaFold A0A075B5S9
Predicted Effect probably damaging
Transcript: ENSMUST00000103482
AA Change: V37E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000100263
Gene: ENSMUSG00000094322
AA Change: V37E

DomainStartEndE-ValueType
IGv 17 98 1.24e-26 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194159
AA Change: V56E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141555
Gene: ENSMUSG00000094322
AA Change: V56E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 5.2e-29 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Ighv9-4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Ighv9-4 APN 12 114299992 missense probably damaging 0.98
R5244:Ighv9-4 UTSW 12 114300251 missense probably benign 0.00
R7133:Ighv9-4 UTSW 12 114300137 missense probably benign 0.00
R7687:Ighv9-4 UTSW 12 114300263 missense not run
R9133:Ighv9-4 UTSW 12 114300263 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCGCACAGAAATACGTAGCCG -3'
(R):5'- CTCATGGCAGCAGCTCAAAG -3'

Sequencing Primer
(F):5'- AGCCGTGTCCTCATTTTTGAG -3'
(R):5'- GGCAGCAGCTCAAAGTAAGACATC -3'
Posted On 2015-06-20