Incidental Mutation 'R4258:Dock9'
ID321919
Institutional Source Beutler Lab
Gene Symbol Dock9
Ensembl Gene ENSMUSG00000025558
Gene Namededicator of cytokinesis 9
SynonymsD14Wsu89e, Zizimin1, B230309H04Rik
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location121542046-121797837 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121581442 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1533 (I1533V)
Ref Sequence ENSEMBL: ENSMUSP00000148328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040700] [ENSMUST00000100299] [ENSMUST00000212181] [ENSMUST00000212376] [ENSMUST00000212416]
Predicted Effect probably benign
Transcript: ENSMUST00000040700
AA Change: I1542V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047881
Gene: ENSMUSG00000025558
AA Change: I1542V

DomainStartEndE-ValueType
Pfam:DUF3398 58 151 5.6e-36 PFAM
PH 172 280 1.38e-16 SMART
Blast:PH 297 372 4e-25 BLAST
Pfam:DOCK-C2 631 822 5.3e-51 PFAM
Pfam:DHR-2 1523 2068 2.1e-212 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100299
AA Change: I1513V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097872
Gene: ENSMUSG00000025558
AA Change: I1513V

DomainStartEndE-ValueType
Pfam:DUF3398 58 153 1.5e-32 PFAM
PH 174 282 1.38e-16 SMART
Blast:PH 299 374 4e-25 BLAST
Pfam:DOCK-C2 632 825 1.3e-59 PFAM
low complexity region 1752 1763 N/A INTRINSIC
Pfam:Ded_cyto 1836 2013 2.4e-69 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211803
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211907
Predicted Effect probably benign
Transcript: ENSMUST00000212181
AA Change: I1543V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212283
AA Change: I1345V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212371
Predicted Effect probably benign
Transcript: ENSMUST00000212376
AA Change: I1533V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect probably benign
Transcript: ENSMUST00000212416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212719
Meta Mutation Damage Score 0.0642 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr122 C A 17: 37,772,058 P135Q probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Dock9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Dock9 APN 14 121668468 missense probably benign 0.12
IGL00817:Dock9 APN 14 121698291 missense probably damaging 0.96
IGL00923:Dock9 APN 14 121607092 unclassified probably benign
IGL01385:Dock9 APN 14 121580583 missense possibly damaging 0.94
IGL01567:Dock9 APN 14 121653084 missense probably damaging 1.00
IGL01767:Dock9 APN 14 121622870 missense possibly damaging 0.91
IGL01811:Dock9 APN 14 121559028 missense probably damaging 1.00
IGL02512:Dock9 APN 14 121619538 splice site probably benign
IGL02525:Dock9 APN 14 121640126 missense probably damaging 1.00
IGL02550:Dock9 APN 14 121698312 start codon destroyed probably null 0.07
IGL02559:Dock9 APN 14 121625147 splice site probably benign
IGL02666:Dock9 APN 14 121580699 missense probably benign 0.42
IGL02674:Dock9 APN 14 121595611 splice site probably null
IGL02795:Dock9 APN 14 121639978 missense probably benign 0.04
IGL03074:Dock9 APN 14 121607270 missense possibly damaging 0.95
IGL03095:Dock9 APN 14 121639528 missense probably damaging 1.00
IGL03294:Dock9 APN 14 121641623 splice site probably benign
R0036:Dock9 UTSW 14 121622853 missense probably damaging 1.00
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0050:Dock9 UTSW 14 121607225 missense probably benign 0.43
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0164:Dock9 UTSW 14 121597665 missense probably damaging 1.00
R0270:Dock9 UTSW 14 121575999 missense probably benign 0.02
R0494:Dock9 UTSW 14 121662584 missense possibly damaging 0.64
R0726:Dock9 UTSW 14 121651768 nonsense probably null
R1029:Dock9 UTSW 14 121599684 splice site probably null
R1214:Dock9 UTSW 14 121586316 missense probably benign 0.02
R1231:Dock9 UTSW 14 121575950 missense possibly damaging 0.61
R1535:Dock9 UTSW 14 121546064 missense probably damaging 1.00
R1629:Dock9 UTSW 14 121543574 missense possibly damaging 0.88
R1637:Dock9 UTSW 14 121651775 missense possibly damaging 0.66
R1733:Dock9 UTSW 14 121626880 missense probably benign 0.01
R1772:Dock9 UTSW 14 121609798 missense probably benign 0.07
R1855:Dock9 UTSW 14 121640159 missense probably damaging 1.00
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1888:Dock9 UTSW 14 121625205 missense probably benign 0.18
R1901:Dock9 UTSW 14 121625153 splice site probably null
R1920:Dock9 UTSW 14 121583380 missense probably damaging 1.00
R1987:Dock9 UTSW 14 121591830 missense probably benign 0.00
R3035:Dock9 UTSW 14 121606837 missense possibly damaging 0.60
R3851:Dock9 UTSW 14 121629086 splice site probably null
R4020:Dock9 UTSW 14 121606855 missense probably benign 0.00
R4021:Dock9 UTSW 14 121626912 missense possibly damaging 0.80
R4089:Dock9 UTSW 14 121583471 missense probably damaging 1.00
R4423:Dock9 UTSW 14 121562053 critical splice donor site probably null
R4561:Dock9 UTSW 14 121559007 missense probably benign 0.01
R4604:Dock9 UTSW 14 121668459 missense probably damaging 1.00
R4646:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4647:Dock9 UTSW 14 121586246 missense probably damaging 1.00
R4776:Dock9 UTSW 14 121610097 missense possibly damaging 0.81
R4809:Dock9 UTSW 14 121546596 missense probably benign 0.37
R4865:Dock9 UTSW 14 121543505 makesense probably null
R4951:Dock9 UTSW 14 121653135 missense probably benign 0.35
R5151:Dock9 UTSW 14 121578170 missense probably damaging 1.00
R5359:Dock9 UTSW 14 121653060 missense possibly damaging 0.69
R5366:Dock9 UTSW 14 121578203 missense probably damaging 1.00
R5502:Dock9 UTSW 14 121610182 splice site probably null
R5579:Dock9 UTSW 14 121599695 missense probably damaging 1.00
R5753:Dock9 UTSW 14 121634625 missense probably benign 0.05
R5836:Dock9 UTSW 14 121681351 missense probably damaging 1.00
R5858:Dock9 UTSW 14 121628792 missense probably benign 0.00
R5890:Dock9 UTSW 14 121668408 critical splice donor site probably null
R6075:Dock9 UTSW 14 121545973 missense probably benign
R6298:Dock9 UTSW 14 121634594 missense probably damaging 1.00
R6306:Dock9 UTSW 14 121562080 missense probably damaging 1.00
R6321:Dock9 UTSW 14 121546021 missense probably damaging 1.00
R6330:Dock9 UTSW 14 121605243 start codon destroyed probably null 0.00
R6719:Dock9 UTSW 14 121610027 missense probably damaging 1.00
R6784:Dock9 UTSW 14 121543514 missense probably damaging 1.00
R6826:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6830:Dock9 UTSW 14 121622918 missense probably damaging 1.00
R6838:Dock9 UTSW 14 121546596 missense possibly damaging 0.71
R6868:Dock9 UTSW 14 121586264 missense probably benign 0.37
R6919:Dock9 UTSW 14 121643152 missense probably benign 0.42
R6989:Dock9 UTSW 14 121627379 missense probably damaging 1.00
R7539:Dock9 UTSW 14 121581436 missense probably damaging 1.00
R7645:Dock9 UTSW 14 121597663 missense probably benign 0.44
R7875:Dock9 UTSW 14 121625984 nonsense probably null
R7900:Dock9 UTSW 14 121546079 missense possibly damaging 0.84
R8040:Dock9 UTSW 14 121651794 missense probably benign 0.06
R8420:Dock9 UTSW 14 121546042 missense probably damaging 1.00
R8511:Dock9 UTSW 14 121627389 missense probably benign 0.40
R8511:Dock9 UTSW 14 121681435 missense probably damaging 1.00
R8514:Dock9 UTSW 14 121658787 missense probably benign 0.25
R8691:Dock9 UTSW 14 121640105 missense possibly damaging 0.49
R8804:Dock9 UTSW 14 121605183 missense probably damaging 0.98
R8894:Dock9 UTSW 14 121622961 missense probably benign 0.10
Z1088:Dock9 UTSW 14 121555275 missense probably damaging 1.00
Z1176:Dock9 UTSW 14 121651782 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGGACTCATGACGGTACCC -3'
(R):5'- TCGCCTTTGTAAATGCATTAGGG -3'

Sequencing Primer
(F):5'- GGACTCATGACGGTACCCACTTTC -3'
(R):5'- GCCTTTGTAAATGCATTAGGGAAAAC -3'
Posted On2015-06-20