Incidental Mutation 'R4258:Olfr122'
ID321922
Institutional Source Beutler Lab
Gene Symbol Olfr122
Ensembl Gene ENSMUSG00000083947
Gene Nameolfactory receptor 122
SynonymsMOR263-10, GA_x6K02T2PSCP-2230932-2231897
MMRRC Submission 041071-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.172) question?
Stock #R4258 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location37768607-37773749 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 37772058 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 135 (P135Q)
Ref Sequence ENSEMBL: ENSMUSP00000149334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119082] [ENSMUST00000172582] [ENSMUST00000217119]
Predicted Effect probably damaging
Transcript: ENSMUST00000119082
AA Change: P144Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113170
Gene: ENSMUSG00000083947
AA Change: P144Q

DomainStartEndE-ValueType
Pfam:7tm_4 46 323 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 50 320 2.7e-6 PFAM
Pfam:7tm_1 56 305 3.8e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172582
AA Change: P135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134283
Gene: ENSMUSG00000083947
AA Change: P135Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 311 9.5e-8 PFAM
Pfam:7tm_1 47 296 7.8e-36 PFAM
Pfam:7tm_4 145 289 1e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215449
Predicted Effect probably damaging
Transcript: ENSMUST00000217119
AA Change: P135Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (60/63)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700080E11Rik T C 9: 105,143,568 I165V probably damaging Het
4932415M13Rik T A 17: 53,724,413 noncoding transcript Het
Ank3 T C 10: 70,004,762 I984T probably benign Het
Arnt2 T C 7: 84,310,955 T204A probably damaging Het
Arsi T C 18: 60,917,316 W424R probably damaging Het
Aspg A T 12: 112,121,253 N346I probably benign Het
Brdt A G 5: 107,359,909 S668G probably damaging Het
Ccdc178 C T 18: 22,017,335 probably null Het
Cfap58 A T 19: 47,949,484 probably null Het
Chaf1a C A 17: 56,056,474 H319Q unknown Het
Colec12 T C 18: 9,720,950 S13P probably damaging Het
Cpne9 C T 6: 113,283,023 probably benign Het
Cyp2c65 A C 19: 39,093,428 D466A probably benign Het
Cyp3a25 T C 5: 145,991,438 K266E probably damaging Het
Dennd1b G T 1: 139,062,940 R214L probably damaging Het
Dock9 T C 14: 121,581,442 I1533V probably benign Het
Dynlt1a C T 17: 6,310,909 M102I probably benign Het
Edil3 G T 13: 89,177,153 L220F probably damaging Het
Eml5 A G 12: 98,865,434 Y383H probably benign Het
Epc1 T A 18: 6,450,130 T393S probably benign Het
Fbxo8 A T 8: 56,588,041 D164V probably benign Het
Gbp4 T A 5: 105,136,975 N16I probably damaging Het
Gdf6 G A 4: 9,844,877 V134I probably damaging Het
Gm21876 C T X: 21,174,928 S45N probably damaging Het
Gm5475 A G 15: 100,424,236 probably benign Het
Gm6430 T G 1: 97,024,836 noncoding transcript Het
Ighv9-4 A T 12: 114,300,145 V56E probably damaging Het
Il3ra A T 14: 14,347,961 N36Y probably damaging Het
Kif7 G T 7: 79,710,513 C325* probably null Het
Lipo2 A T 19: 33,730,928 F229I possibly damaging Het
Lrba A G 3: 86,445,349 K1935E probably damaging Het
Mki67 A T 7: 135,695,288 D2672E possibly damaging Het
Mtf1 A G 4: 124,838,783 T545A probably benign Het
Mup6 A T 4: 60,004,812 probably null Het
Myo9b T C 8: 71,355,765 V1672A probably damaging Het
Olfr1164 T A 2: 88,093,018 N306I probably damaging Het
Olfr1280 A T 2: 111,315,638 H53L probably benign Het
Olfr16 C T 1: 172,957,638 T281I possibly damaging Het
Pcdhgb2 A T 18: 37,692,049 I698F probably damaging Het
Pkn3 C T 2: 30,088,560 H665Y probably damaging Het
Ppil6 T A 10: 41,507,535 L99* probably null Het
Psg22 T A 7: 18,724,629 V376E probably damaging Het
Pum1 G A 4: 130,730,280 R201H probably damaging Het
Rasa2 A T 9: 96,557,380 probably benign Het
Schip1 T A 3: 68,618,630 M379K possibly damaging Het
Scn9a A T 2: 66,565,054 probably benign Het
Sh3tc1 C T 5: 35,706,978 A622T probably benign Het
Smarcd2 A T 11: 106,265,250 I292N probably damaging Het
Stab1 G A 14: 31,154,672 R862C possibly damaging Het
Tdrd5 T A 1: 156,259,742 H870L probably benign Het
Tnfaip8 A G 18: 50,090,376 R60G possibly damaging Het
Traf3ip3 C T 1: 193,197,946 R25Q probably damaging Het
Unc5b T C 10: 60,765,371 Y892C probably damaging Het
Vmn2r2 T G 3: 64,134,697 D199A probably damaging Het
Washc2 C A 6: 116,208,241 P12Q probably damaging Het
Zfp286 T C 11: 62,781,070 I121V probably benign Het
Zfp606 T A 7: 12,494,340 probably null Het
Other mutations in Olfr122
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Olfr122 APN 17 37772614 missense probably benign 0.00
IGL01338:Olfr122 APN 17 37771839 missense possibly damaging 0.90
IGL01447:Olfr122 APN 17 37772231 missense probably damaging 1.00
PIT4514001:Olfr122 UTSW 17 37771867 missense probably damaging 1.00
R0402:Olfr122 UTSW 17 37772393 missense probably damaging 1.00
R0830:Olfr122 UTSW 17 37771913 missense probably damaging 0.99
R2018:Olfr122 UTSW 17 37772576 missense probably benign 0.00
R6371:Olfr122 UTSW 17 37772435 missense probably benign
R6481:Olfr122 UTSW 17 37772303 missense probably damaging 1.00
R7468:Olfr122 UTSW 17 37772019 missense probably damaging 1.00
R7492:Olfr122 UTSW 17 37771680 missense possibly damaging 0.53
R8114:Olfr122 UTSW 17 37771989 missense possibly damaging 0.67
R8172:Olfr122 UTSW 17 37772435 missense probably benign
R8728:Olfr122 UTSW 17 37771751 missense probably damaging 1.00
Z1177:Olfr122 UTSW 17 37772191 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCCAATTTGTCTCTCCTGG -3'
(R):5'- AGCCTCATTTTGGGATGTATCTCC -3'

Sequencing Primer
(F):5'- GAGATCGGCTACACTTGCTCTG -3'
(R):5'- TGTATCTCCACAGGCAAGTG -3'
Posted On2015-06-20