Incidental Mutation 'R4283:Cga'
ID321944
Institutional Source Beutler Lab
Gene Symbol Cga
Ensembl Gene ENSMUSG00000028298
Gene Nameglycoprotein hormones, alpha subunit
SynonymsGPHalpha, alphaSU, aGSU, alphaGSU, alpha-GSU, Tsha
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.856) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location34893779-34907370 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 34905264 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029975] [ENSMUST00000108130] [ENSMUST00000135871]
Predicted Effect probably null
Transcript: ENSMUST00000029975
SMART Domains Protein: ENSMUSP00000029975
Gene: ENSMUSG00000028298

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108130
SMART Domains Protein: ENSMUSP00000103765
Gene: ENSMUSG00000028298

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 120 3.31e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125820
Predicted Effect probably null
Transcript: ENSMUST00000135871
SMART Domains Protein: ENSMUSP00000119152
Gene: ENSMUSG00000028298

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
GHA 34 117 7.56e-52 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149572
Meta Mutation Damage Score 0.9469 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mutants exhibit male and female sterility with hypogonadism, dwarfism, hypothyroidism, and both hypertrophy and hyperplasia of pituitary thyrotropes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Ptpn21 T C 12: 98,733,475 E60G probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Slc17a6 A G 7: 51,645,076 Y177C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tas2r143 T A 6: 42,401,073 probably null Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Cga
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5382:Cga UTSW 4 34904048 missense probably benign
R5743:Cga UTSW 4 34904108 critical splice donor site probably null
R6952:Cga UTSW 4 34905171 missense possibly damaging 0.80
R7388:Cga UTSW 4 34907076 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTAGGTTGCCCAGAATGTAAAC -3'
(R):5'- AACTCCTTTTATGCGAGTCCAC -3'

Sequencing Primer
(F):5'- TTGCCCAGAATGTAAACTAAAGG -3'
(R):5'- CACTGGCTTTTTAGACTGTGGCAAC -3'
Posted On2015-06-20