Incidental Mutation 'R4283:Tas2r143'
ID321945
Institutional Source Beutler Lab
Gene Symbol Tas2r143
Ensembl Gene ENSMUSG00000046652
Gene Nametaste receptor, type 2, member 143
Synonymsmt2r36, Tas2r43
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42400238-42401119 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 42401073 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057398] [ENSMUST00000070178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057398
AA Change: L279Q

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057910
Gene: ENSMUSG00000046652
AA Change: L279Q

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 6.7e-68 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000070178
SMART Domains Protein: ENSMUSP00000070247
Gene: ENSMUSG00000056203

DomainStartEndE-ValueType
Pfam:TAS2R 22 320 1.3e-63 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cga T C 4: 34,905,264 probably null Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Ptpn21 T C 12: 98,733,475 E60G probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Slc17a6 A G 7: 51,645,076 Y177C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r123 G A 6: 132,848,045 V302I possibly damaging Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Tas2r143
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02216:Tas2r143 APN 6 42400334 nonsense probably null
IGL02832:Tas2r143 APN 6 42400325 missense possibly damaging 0.55
R0125:Tas2r143 UTSW 6 42400955 missense probably benign 0.01
R1035:Tas2r143 UTSW 6 42400265 missense probably benign 0.16
R1073:Tas2r143 UTSW 6 42400760 missense probably benign 0.01
R1400:Tas2r143 UTSW 6 42400383 missense probably benign 0.35
R1774:Tas2r143 UTSW 6 42400371 missense probably damaging 1.00
R2391:Tas2r143 UTSW 6 42400876 missense probably damaging 0.99
R3617:Tas2r143 UTSW 6 42401063 missense probably benign 0.20
R3693:Tas2r143 UTSW 6 42400976 missense probably benign 0.00
R4486:Tas2r143 UTSW 6 42400694 missense probably benign 0.15
R5005:Tas2r143 UTSW 6 42400724 missense probably benign 0.02
R6360:Tas2r143 UTSW 6 42400835 missense probably benign 0.40
R7163:Tas2r143 UTSW 6 42400268 missense probably benign
R7827:Tas2r143 UTSW 6 42400722 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCAGGCACATACCATGGC -3'
(R):5'- TTGGAACTCAGACCAGGAAC -3'

Sequencing Primer
(F):5'- GGCACATACCATGGCTCTGAAATC -3'
(R):5'- CTCAGACCAGGAACTAACATAAATG -3'
Posted On2015-06-20