Incidental Mutation 'R4283:Tas2r123'
ID321949
Institutional Source Beutler Lab
Gene Symbol Tas2r123
Ensembl Gene ENSMUSG00000057381
Gene Nametaste receptor, type 2, member 123
Synonymsmt2r55, Tas2r23, STC 9-2, mGR23, T2R23
MMRRC Submission 041651-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4283 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location132847142-132848143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 132848045 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 302 (V302I)
Ref Sequence ENSEMBL: ENSMUSP00000071615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071696]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071696
AA Change: V302I

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000071615
Gene: ENSMUSG00000057381
AA Change: V302I

DomainStartEndE-ValueType
Pfam:TAS2R 7 322 4.6e-79 PFAM
Meta Mutation Damage Score 0.1146 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6030468B19Rik A G 11: 117,806,261 T229A probably benign Het
Adgrg5 T G 8: 94,937,698 V312G probably benign Het
Arl6ip1 AAAATAAATAAATAAATAAATAAATA AAAATAAATAAATAAATAAATAAATAAATA 7: 118,121,899 probably benign Het
Camk2b A C 11: 5,987,099 S327A probably benign Het
Card9 A G 2: 26,357,297 I280T possibly damaging Het
Cd274 A T 19: 29,380,471 M188L probably benign Het
Cga T C 4: 34,905,264 probably null Het
Copg1 C T 6: 87,908,545 T723M probably damaging Het
Cplx2 A G 13: 54,379,564 E87G probably damaging Het
Crtc2 A G 3: 90,259,236 probably benign Het
Defa27 A G 8: 21,315,616 N24S probably benign Het
Defb40 A G 8: 18,978,077 S14P probably damaging Het
Dnmt3a G A 12: 3,901,665 G681R probably damaging Het
Ghr C A 15: 3,333,448 V181L possibly damaging Het
Gm10750 A G 2: 149,015,996 F112L unknown Het
Gm17541 A G 12: 4,689,656 probably benign Het
Gmip T A 8: 69,813,601 probably benign Het
Hdac10 A G 15: 89,125,623 L402P possibly damaging Het
Hsd17b12 G C 2: 94,033,586 R304G unknown Het
Iqgap3 T C 3: 88,098,860 V526A probably benign Het
Ncaph A G 2: 127,121,085 probably benign Het
Ninl T C 2: 150,953,416 probably benign Het
Pcgf1 T A 6: 83,079,733 L90Q probably damaging Het
Pcsk4 C A 10: 80,329,453 probably benign Het
Ptpn21 T C 12: 98,733,475 E60G probably damaging Het
Rec8 A G 14: 55,618,634 H11R probably damaging Het
Ric1 A G 19: 29,586,550 Y568C probably damaging Het
Slc17a6 A G 7: 51,645,076 Y177C probably damaging Het
Tas2r104 C T 6: 131,685,411 A112T probably damaging Het
Tas2r143 T A 6: 42,401,073 probably null Het
Tfeb A G 17: 47,789,774 E305G probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Upf2 A G 2: 5,973,558 N411S unknown Het
Vmn2r52 C T 7: 10,170,638 G425R possibly damaging Het
Zfp28 A T 7: 6,393,701 Q378H probably benign Het
Zfp429 A C 13: 67,390,795 C177G probably damaging Het
Other mutations in Tas2r123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01021:Tas2r123 APN 6 132847406 missense probably benign 0.01
IGL01547:Tas2r123 APN 6 132847458 missense probably damaging 1.00
IGL02576:Tas2r123 APN 6 132847740 missense possibly damaging 0.96
IGL03303:Tas2r123 APN 6 132847438 missense probably damaging 1.00
R0068:Tas2r123 UTSW 6 132847992 missense possibly damaging 0.66
R0068:Tas2r123 UTSW 6 132847992 missense possibly damaging 0.66
R0110:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R0364:Tas2r123 UTSW 6 132847681 missense probably benign
R0415:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R0469:Tas2r123 UTSW 6 132847332 missense probably benign 0.01
R1791:Tas2r123 UTSW 6 132847565 missense probably damaging 1.00
R1976:Tas2r123 UTSW 6 132847332 missense probably damaging 0.96
R2328:Tas2r123 UTSW 6 132847316 missense probably benign 0.02
R4282:Tas2r123 UTSW 6 132848045 missense possibly damaging 0.75
R4939:Tas2r123 UTSW 6 132847845 missense probably benign 0.32
R5079:Tas2r123 UTSW 6 132847718 missense probably benign 0.01
R5241:Tas2r123 UTSW 6 132847218 missense probably benign 0.06
R5288:Tas2r123 UTSW 6 132847227 missense probably benign 0.17
R5851:Tas2r123 UTSW 6 132847308 missense probably damaging 1.00
R6725:Tas2r123 UTSW 6 132847838 missense probably damaging 0.97
R6895:Tas2r123 UTSW 6 132847170 missense probably benign
R7017:Tas2r123 UTSW 6 132847550 missense probably benign 0.00
R7183:Tas2r123 UTSW 6 132847698 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGCAGGTCAATGCCAAACA -3'
(R):5'- AGGATTGAAGCCCCACTTTT -3'

Sequencing Primer
(F):5'- CTAGAGATGTCAGTACTATGGCCC -3'
(R):5'- GGATTGAAGCCCCACTTTTTATTTTC -3'
Posted On2015-06-20