Mutagenetix > Incidental Mutations

Incidental Mutation 'R4283:Ric1'

321970

Institutional Source

Beutler Lab

Gene Symbol

Ric1

Ensembl Gene

ENSMUSG00000038658

Gene Name

RAB6A GEF complex partner 1

Synonyms

C030046E11Rik, C130057E09Rik

MMRRC Submission

041651-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.554) question?

Stock #

R4283 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29522282-29606829 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 29586550 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 568 (Y568C)

Ref Sequence

ENSEMBL: ENSMUSP00000043437 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043610]

Predicted Effect

probably damaging
Transcript: ENSMUST00000043610
AA Change: Y568C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043437
Gene: ENSMUSG00000038658
AA Change: Y568C

Domain	Start	End	E-Value	Type
Blast:WD40	242	278	5e-7	BLAST
SCOP:d1gxra_	254	379	2e-4	SMART
Blast:WD40	285	334	3e-6	BLAST
Blast:WD40	482	520	5e-6	BLAST
low complexity region	642	653	N/A	INTRINSIC
Pfam:RIC1	732	991	1.9e-86	PFAM
low complexity region	1120	1132	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000162492
AA Change: Y459C

SMART Domains

Protein: ENSMUSP00000124727
Gene: ENSMUSG00000038658
AA Change: Y459C

Domain	Start	End	E-Value	Type
Blast:WD40	171	207	4e-7	BLAST
SCOP:d1gxra_	183	308	2e-4	SMART
Blast:WD40	214	263	2e-6	BLAST
low complexity region	534	545	N/A	INTRINSIC
Pfam:RIC1	624	883	1.6e-86	PFAM
low complexity region	1012	1024	N/A	INTRINSIC

Meta Mutation Damage Score

0.9314

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

100% (41/41)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
6030468B19Rik	A	G	11: 117,806,261	T229A	probably benign	Het
Adgrg5	T	G	8: 94,937,698	V312G	probably benign	Het
Arl6ip1	AAAATAAATAAATAAATAAATAAATA	AAAATAAATAAATAAATAAATAAATAAATA	7: 118,121,899		probably benign	Het
Camk2b	A	C	11: 5,987,099	S327A	probably benign	Het
Card9	A	G	2: 26,357,297	I280T	possibly damaging	Het
Cd274	A	T	19: 29,380,471	M188L	probably benign	Het
Cga	T	C	4: 34,905,264		probably null	Het
Copg1	C	T	6: 87,908,545	T723M	probably damaging	Het
Cplx2	A	G	13: 54,379,564	E87G	probably damaging	Het
Crtc2	A	G	3: 90,259,236		probably benign	Het
Defa27	A	G	8: 21,315,616	N24S	probably benign	Het
Defb40	A	G	8: 18,978,077	S14P	probably damaging	Het
Dnmt3a	G	A	12: 3,901,665	G681R	probably damaging	Het
Ghr	C	A	15: 3,333,448	V181L	possibly damaging	Het
Gm10750	A	G	2: 149,015,996	F112L	unknown	Het
Gm17541	A	G	12: 4,689,656		probably benign	Het
Gmip	T	A	8: 69,813,601		probably benign	Het
Hdac10	A	G	15: 89,125,623	L402P	possibly damaging	Het
Hsd17b12	G	C	2: 94,033,586	R304G	unknown	Het
Iqgap3	T	C	3: 88,098,860	V526A	probably benign	Het
Ncaph	A	G	2: 127,121,085		probably benign	Het
Ninl	T	C	2: 150,953,416		probably benign	Het
Pcgf1	T	A	6: 83,079,733	L90Q	probably damaging	Het
Pcsk4	C	A	10: 80,329,453		probably benign	Het
Ptpn21	T	C	12: 98,733,475	E60G	probably damaging	Het
Rec8	A	G	14: 55,618,634	H11R	probably damaging	Het
Slc17a6	A	G	7: 51,645,076	Y177C	probably damaging	Het
Tas2r104	C	T	6: 131,685,411	A112T	probably damaging	Het
Tas2r123	G	A	6: 132,848,045	V302I	possibly damaging	Het
Tas2r143	T	A	6: 42,401,073		probably null	Het
Tfeb	A	G	17: 47,789,774	E305G	probably damaging	Het
Ttn	T	A	2: 76,754,824	I22042F	probably damaging	Het
Upf2	A	G	2: 5,973,558	N411S	unknown	Het
Vmn2r52	C	T	7: 10,170,638	G425R	possibly damaging	Het
Zfp28	A	T	7: 6,393,701	Q378H	probably benign	Het
Zfp429	A	C	13: 67,390,795	C177G	probably damaging	Het

Other mutations in Ric1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00574:Ric1	APN	19	29595362	missense	probably damaging	1.00
IGL00902:Ric1	APN	19	29567231	missense	probably benign	0.05
IGL01405:Ric1	APN	19	29567370	splice site	probably benign
IGL01629:Ric1	APN	19	29603981	missense	probably benign	0.02
IGL01688:Ric1	APN	19	29577614	missense	probably benign	0.00
IGL01966:Ric1	APN	19	29595563	missense	probably benign	0.33
IGL02123:Ric1	APN	19	29594800	missense	probably benign
IGL02590:Ric1	APN	19	29567481	splice site	probably benign
IGL02655:Ric1	APN	19	29595451	missense	probably damaging	1.00
IGL02699:Ric1	APN	19	29522557	missense	possibly damaging	0.51
IGL02718:Ric1	APN	19	29533240	missense	probably damaging	1.00
IGL03026:Ric1	APN	19	29599833	missense	probably benign	0.02
IGL03142:Ric1	APN	19	29600980	missense	possibly damaging	0.89
R0109:Ric1	UTSW	19	29586677	synonymous	silent
R0336:Ric1	UTSW	19	29587793	missense	probably damaging	0.96
R0362:Ric1	UTSW	19	29601011	critical splice donor site	probably null
R0676:Ric1	UTSW	19	29577647	missense	probably benign
R0734:Ric1	UTSW	19	29594818	missense	possibly damaging	0.66
R1004:Ric1	UTSW	19	29602357	missense	probably benign	0.00
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1148:Ric1	UTSW	19	29579849	missense	probably benign
R1216:Ric1	UTSW	19	29577735	missense	probably benign	0.00
R1493:Ric1	UTSW	19	29579849	missense	probably benign
R1848:Ric1	UTSW	19	29600813	splice site	probably null
R1872:Ric1	UTSW	19	29602668	missense	probably benign	0.32
R1942:Ric1	UTSW	19	29601016	splice site	probably benign
R2143:Ric1	UTSW	19	29533252	missense	probably damaging	1.00
R2143:Ric1	UTSW	19	29533253	missense	probably damaging	0.96
R2679:Ric1	UTSW	19	29604030	missense	probably benign
R2878:Ric1	UTSW	19	29602330	missense	possibly damaging	0.77
R2970:Ric1	UTSW	19	29577718	missense	probably benign	0.15
R3420:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3421:Ric1	UTSW	19	29567590	missense	probably damaging	0.96
R3940:Ric1	UTSW	19	29570762	missense	probably damaging	1.00
R4004:Ric1	UTSW	19	29579801	missense	probably benign	0.44
R4225:Ric1	UTSW	19	29602731	missense	possibly damaging	0.89
R4280:Ric1	UTSW	19	29586550	missense	probably damaging	1.00
R4516:Ric1	UTSW	19	29570765	missense	probably benign	0.17
R4702:Ric1	UTSW	19	29598017	missense	possibly damaging	0.85
R4824:Ric1	UTSW	19	29585842	missense	probably damaging	1.00
R4835:Ric1	UTSW	19	29595536	missense	possibly damaging	0.80
R5860:Ric1	UTSW	19	29599845	missense	possibly damaging	0.91
R5883:Ric1	UTSW	19	29595989	missense	probably damaging	1.00
R5965:Ric1	UTSW	19	29570771	missense	probably damaging	0.99
R6141:Ric1	UTSW	19	29595442	missense	probably damaging	1.00
R6236:Ric1	UTSW	19	29595426	missense	possibly damaging	0.91
R6271:Ric1	UTSW	19	29567365	splice site	probably null
R6345:Ric1	UTSW	19	29604085	missense	probably benign	0.09
R6371:Ric1	UTSW	19	29562026	missense	probably benign	0.35
R6547:Ric1	UTSW	19	29594826	missense	probably damaging	1.00
R6924:Ric1	UTSW	19	29569388	missense	probably damaging	0.98
R6969:Ric1	UTSW	19	29585782	missense	probably damaging	1.00
R6970:Ric1	UTSW	19	29587772	missense	probably damaging	1.00
R6993:Ric1	UTSW	19	29586613	missense	probably damaging	1.00
R7296:Ric1	UTSW	19	29584578	critical splice donor site	probably null
R7434:Ric1	UTSW	19	29574780	missense	probably damaging	1.00
R7619:Ric1	UTSW	19	29579775	missense	probably benign	0.32
R7850:Ric1	UTSW	19	29594893	missense	probably benign
R7933:Ric1	UTSW	19	29594893	missense	probably benign
X0064:Ric1	UTSW	19	29587802	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACACAGATCTGATACGTGGTCTC -3'
(R):5'- TTCCTCCCCATAACACAGGG -3'

Sequencing Primer
(F):5'- GATCTGATACGTGGTCTCATAATTC -3'
(R):5'- GAGAAAAGCAGGTTCTTGTGC -3'

Posted On

2015-06-20