Incidental Mutation 'R4284:Cilp'
ID 322002
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Name cartilage intermediate layer protein, nucleotide pyrophosphohydrolase
Synonyms C130036G17Rik
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4284 (G1)
Quality Score 225
Status Not validated
Chromosome 9
Chromosomal Location 65172462-65187887 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65185560 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 552 (T552S)
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000048762
AA Change: T552S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: T552S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Agl G A 3: 116,545,827 (GRCm39) S1323L possibly damaging Het
Capg T C 6: 72,538,082 (GRCm39) Y323H probably damaging Het
Cdh23 T C 10: 60,139,272 (GRCm39) T3314A possibly damaging Het
Cox16 T C 12: 81,521,293 (GRCm39) probably null Het
Ctu2 G A 8: 123,204,978 (GRCm39) V88I probably benign Het
Elfn1 A T 5: 139,958,069 (GRCm39) K358* probably null Het
Enpp6 T C 8: 47,522,050 (GRCm39) F328S probably damaging Het
Galnt12 T C 4: 47,104,231 (GRCm39) L163P probably damaging Het
Gcfc2 G A 6: 81,918,372 (GRCm39) R354H probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 118,112,269 (GRCm39) probably benign Het
Ikbke C T 1: 131,203,515 (GRCm39) probably null Het
Il1rn T C 2: 24,239,557 (GRCm39) L151P probably damaging Het
Jmjd6 T C 11: 116,733,534 (GRCm39) R48G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lilra6 T C 7: 3,911,803 (GRCm39) H285R possibly damaging Het
Lrp2 G A 2: 69,310,438 (GRCm39) R2712C possibly damaging Het
Magi3 C A 3: 103,923,184 (GRCm39) G1178* probably null Het
Memo1 T C 17: 74,562,293 (GRCm39) probably null Het
Mug2 T A 6: 122,040,632 (GRCm39) D727E probably benign Het
Relch A G 1: 105,649,012 (GRCm39) D717G probably damaging Het
Sema3c A G 5: 17,883,345 (GRCm39) T318A probably benign Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc20a2 G A 8: 23,051,365 (GRCm39) R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 (GRCm39) V141M probably benign Het
Sox5 T C 6: 143,781,055 (GRCm39) K570E probably damaging Het
Ssbp1 T G 6: 40,454,851 (GRCm39) probably null Het
Sult5a1 A G 8: 123,875,969 (GRCm39) S116P probably damaging Het
Tktl2 T A 8: 66,965,808 (GRCm39) D455E probably damaging Het
Tm9sf1 T C 14: 55,878,780 (GRCm39) Y204C probably damaging Het
Tmem161a A G 8: 70,630,076 (GRCm39) probably benign Het
Ttn T A 2: 76,623,211 (GRCm39) K13663* probably null Het
Unc5c T C 3: 141,420,435 (GRCm39) I52T probably damaging Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL01340:Cilp APN 9 65,183,256 (GRCm39) missense probably damaging 0.99
IGL02330:Cilp APN 9 65,181,804 (GRCm39) splice site probably benign
IGL02729:Cilp APN 9 65,185,372 (GRCm39) missense possibly damaging 0.63
IGL02833:Cilp APN 9 65,185,206 (GRCm39) missense probably benign
IGL02961:Cilp APN 9 65,185,891 (GRCm39) missense possibly damaging 0.88
IGL03137:Cilp APN 9 65,185,450 (GRCm39) missense probably benign
IGL03211:Cilp APN 9 65,187,457 (GRCm39) missense probably benign
IGL03301:Cilp APN 9 65,187,499 (GRCm39) missense probably benign 0.01
IGL03341:Cilp APN 9 65,185,284 (GRCm39) missense probably benign 0.07
ANU05:Cilp UTSW 9 65,186,265 (GRCm39) missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02988:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL02991:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03014:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03050:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03054:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03055:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03097:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03098:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03134:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03138:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
IGL03147:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
R0096:Cilp UTSW 9 65,180,952 (GRCm39) missense possibly damaging 0.57
R0219:Cilp UTSW 9 65,176,872 (GRCm39) missense possibly damaging 0.64
R0347:Cilp UTSW 9 65,187,435 (GRCm39) missense probably benign
R0699:Cilp UTSW 9 65,177,608 (GRCm39) missense probably damaging 1.00
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1148:Cilp UTSW 9 65,187,598 (GRCm39) missense possibly damaging 0.96
R1155:Cilp UTSW 9 65,176,869 (GRCm39) missense probably benign 0.01
R1544:Cilp UTSW 9 65,183,127 (GRCm39) missense probably benign 0.03
R1584:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R1586:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2055:Cilp UTSW 9 65,186,997 (GRCm39) missense probably damaging 1.00
R2069:Cilp UTSW 9 65,185,372 (GRCm39) missense possibly damaging 0.63
R2070:Cilp UTSW 9 65,186,377 (GRCm39) missense probably damaging 1.00
R2414:Cilp UTSW 9 65,181,927 (GRCm39) splice site probably benign
R4630:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4632:Cilp UTSW 9 65,187,162 (GRCm39) missense probably benign 0.17
R4870:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
R4908:Cilp UTSW 9 65,185,302 (GRCm39) missense probably benign 0.17
R5568:Cilp UTSW 9 65,187,515 (GRCm39) missense probably benign 0.04
R5621:Cilp UTSW 9 65,186,073 (GRCm39) missense possibly damaging 0.71
R5889:Cilp UTSW 9 65,187,625 (GRCm39) missense possibly damaging 0.93
R6645:Cilp UTSW 9 65,186,587 (GRCm39) missense possibly damaging 0.66
R6878:Cilp UTSW 9 65,187,129 (GRCm39) missense probably damaging 1.00
R6982:Cilp UTSW 9 65,187,087 (GRCm39) missense probably damaging 1.00
R7330:Cilp UTSW 9 65,187,527 (GRCm39) missense probably benign
R7967:Cilp UTSW 9 65,185,494 (GRCm39) missense possibly damaging 0.80
R8305:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8306:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8307:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8308:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8386:Cilp UTSW 9 65,186,286 (GRCm39) missense probably damaging 0.98
R8407:Cilp UTSW 9 65,181,898 (GRCm39) missense probably damaging 1.00
R8542:Cilp UTSW 9 65,185,405 (GRCm39) missense probably damaging 1.00
R8794:Cilp UTSW 9 65,186,535 (GRCm39) missense probably benign 0.26
R8951:Cilp UTSW 9 65,180,220 (GRCm39) missense probably benign 0.01
R9060:Cilp UTSW 9 65,186,302 (GRCm39) missense probably benign 0.01
R9257:Cilp UTSW 9 65,174,451 (GRCm39) missense possibly damaging 0.72
R9265:Cilp UTSW 9 65,187,333 (GRCm39) missense probably benign
R9358:Cilp UTSW 9 65,183,269 (GRCm39) missense probably benign
R9401:Cilp UTSW 9 65,185,381 (GRCm39) missense probably damaging 0.98
X0024:Cilp UTSW 9 65,186,925 (GRCm39) missense probably damaging 1.00
X0025:Cilp UTSW 9 65,186,980 (GRCm39) missense probably damaging 1.00
Z1088:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1176:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Z1177:Cilp UTSW 9 65,187,412 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCACTGCTGCTGACAAC -3'
(R):5'- ATGTTCCGAGGATCCAGGAAG -3'

Sequencing Primer
(F):5'- TGACAACGGGGAGCCCATG -3'
(R):5'- ATCCAGGAAGGTCACGCTG -3'
Posted On 2015-06-20