Incidental Mutation 'R4284:Cilp'
ID322002
Institutional Source Beutler Lab
Gene Symbol Cilp
Ensembl Gene ENSMUSG00000042254
Gene Namecartilage intermediate layer protein, nucleotide pyrophosphohydrolase
SynonymsC130036G17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4284 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location65265180-65280605 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 65278278 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 552 (T552S)
Ref Sequence ENSEMBL: ENSMUSP00000036631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048762] [ENSMUST00000141382]
Predicted Effect probably damaging
Transcript: ENSMUST00000048762
AA Change: T552S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036631
Gene: ENSMUSG00000042254
AA Change: T552S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Mucin2_WxxW 55 139 1.9e-24 PFAM
TSP1 152 201 3.09e-10 SMART
low complexity region 233 242 N/A INTRINSIC
IGc2 321 383 4.45e-10 SMART
low complexity region 1154 1170 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141382
SMART Domains Protein: ENSMUSP00000121326
Gene: ENSMUSG00000042254

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Major alterations in the composition of the cartilage extracellular matrix occur in joint disease, such as osteoarthrosis. This gene encodes the cartilage intermediate layer protein (CILP), which increases in early osteoarthrosis cartilage. The encoded protein was thought to encode a protein precursor for two different proteins; an N-terminal CILP and a C-terminal homolog of NTPPHase, however, later studies identified no nucleotide pyrophosphatase phosphodiesterase (NPP) activity. The full-length and the N-terminal domain of this protein was shown to function as an IGF-1 antagonist. An allelic variant of this gene has been associated with lumbar disc disease. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,721,287 D717G probably damaging Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Capg T C 6: 72,561,099 Y323H probably damaging Het
Cdh23 T C 10: 60,303,493 T3314A possibly damaging Het
Cox16 T C 12: 81,474,519 probably null Het
Ctu2 G A 8: 122,478,239 V88I probably benign Het
Elfn1 A T 5: 139,972,314 K358* probably null Het
Enpp6 T C 8: 47,069,015 F328S probably damaging Het
Galnt12 T C 4: 47,104,231 L163P probably damaging Het
Gcfc2 G A 6: 81,941,391 R354H probably damaging Het
Hcn1 ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC 13: 117,975,733 probably benign Het
Ikbke C T 1: 131,275,778 probably null Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Jmjd6 T C 11: 116,842,708 R48G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lilra6 T C 7: 3,908,804 H285R possibly damaging Het
Lrp2 G A 2: 69,480,094 R2712C possibly damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Memo1 T C 17: 74,255,298 probably null Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Sema3c A G 5: 17,678,347 T318A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sox5 T C 6: 143,835,329 K570E probably damaging Het
Ssbp1 T G 6: 40,477,917 probably null Het
Sult5a1 A G 8: 123,149,230 S116P probably damaging Het
Tktl2 T A 8: 66,513,156 D455E probably damaging Het
Tm9sf1 T C 14: 55,641,323 Y204C probably damaging Het
Tmem161a A G 8: 70,177,426 probably benign Het
Ttn T A 2: 76,792,867 K13663* probably null Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Other mutations in Cilp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Cilp APN 9 65278983 missense possibly damaging 0.80
IGL01340:Cilp APN 9 65275974 missense probably damaging 0.99
IGL02330:Cilp APN 9 65274522 splice site probably benign
IGL02729:Cilp APN 9 65278090 missense possibly damaging 0.63
IGL02833:Cilp APN 9 65277924 missense probably benign
IGL02961:Cilp APN 9 65278609 missense possibly damaging 0.88
IGL03137:Cilp APN 9 65278168 missense probably benign
IGL03211:Cilp APN 9 65280175 missense probably benign
IGL03301:Cilp APN 9 65280217 missense probably benign 0.01
IGL03341:Cilp APN 9 65278002 missense probably benign 0.07
ANU05:Cilp UTSW 9 65278983 missense possibly damaging 0.80
IGL02984:Cilp UTSW 9 65280130 frame shift probably null
IGL02988:Cilp UTSW 9 65280130 frame shift probably null
IGL02991:Cilp UTSW 9 65280130 frame shift probably null
IGL03014:Cilp UTSW 9 65280130 frame shift probably null
IGL03050:Cilp UTSW 9 65280130 frame shift probably null
IGL03054:Cilp UTSW 9 65280130 frame shift probably null
IGL03055:Cilp UTSW 9 65280130 frame shift probably null
IGL03097:Cilp UTSW 9 65280130 frame shift probably null
IGL03098:Cilp UTSW 9 65280130 frame shift probably null
IGL03134:Cilp UTSW 9 65280130 frame shift probably null
IGL03138:Cilp UTSW 9 65280130 frame shift probably null
IGL03147:Cilp UTSW 9 65280130 frame shift probably null
R0096:Cilp UTSW 9 65273670 missense possibly damaging 0.57
R0219:Cilp UTSW 9 65269590 missense possibly damaging 0.64
R0347:Cilp UTSW 9 65280153 missense probably benign
R0699:Cilp UTSW 9 65270326 missense probably damaging 1.00
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1148:Cilp UTSW 9 65280316 missense possibly damaging 0.96
R1155:Cilp UTSW 9 65269587 missense probably benign 0.01
R1544:Cilp UTSW 9 65275845 missense probably benign 0.03
R1584:Cilp UTSW 9 65279715 missense probably damaging 1.00
R1586:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2055:Cilp UTSW 9 65279715 missense probably damaging 1.00
R2069:Cilp UTSW 9 65278090 missense possibly damaging 0.63
R2070:Cilp UTSW 9 65279095 missense probably damaging 1.00
R2414:Cilp UTSW 9 65274645 splice site probably benign
R4630:Cilp UTSW 9 65279880 missense probably benign 0.17
R4632:Cilp UTSW 9 65279880 missense probably benign 0.17
R4870:Cilp UTSW 9 65279698 missense probably damaging 1.00
R4908:Cilp UTSW 9 65278020 missense probably benign 0.17
R5568:Cilp UTSW 9 65280233 missense probably benign 0.04
R5621:Cilp UTSW 9 65278791 missense possibly damaging 0.71
R5889:Cilp UTSW 9 65280343 missense possibly damaging 0.93
R6645:Cilp UTSW 9 65279305 missense possibly damaging 0.66
R6878:Cilp UTSW 9 65279847 missense probably damaging 1.00
R6982:Cilp UTSW 9 65279805 missense probably damaging 1.00
R7330:Cilp UTSW 9 65280245 missense probably benign
X0024:Cilp UTSW 9 65279643 missense probably damaging 1.00
X0025:Cilp UTSW 9 65279698 missense probably damaging 1.00
Z1088:Cilp UTSW 9 65280130 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTCACTGCTGCTGACAAC -3'
(R):5'- ATGTTCCGAGGATCCAGGAAG -3'

Sequencing Primer
(F):5'- TGACAACGGGGAGCCCATG -3'
(R):5'- ATCCAGGAAGGTCACGCTG -3'
Posted On2015-06-20