Incidental Mutation 'R4284:Hcn1'
ID322006
Institutional Source Beutler Lab
Gene Symbol Hcn1
Ensembl Gene ENSMUSG00000021730
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 1
SynonymsHAC2, Bcng1, C630013B14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4284 (G1)
Quality Score118
Status Not validated
Chromosome13
Chromosomal Location117602320-117987418 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) ACAGCAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC to ACAGCAGCAGCAGCAGCAGCAACAGCAACAACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGC at 117975733 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006991]
PDB Structure
Tetramerization dynamics of the C-terminus underlies isoform-specific cAMP-gating in HCN channels [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000006991
SMART Domains Protein: ENSMUSP00000006991
Gene: ENSMUSG00000021730

DomainStartEndE-ValueType
Pfam:Ion_trans_N 87 130 8.2e-24 PFAM
Pfam:Ion_trans 131 394 2.1e-23 PFAM
low complexity region 395 406 N/A INTRINSIC
Blast:cNMP 407 439 4e-13 BLAST
cNMP 464 580 1.95e-22 SMART
low complexity region 639 655 N/A INTRINSIC
low complexity region 660 680 N/A INTRINSIC
low complexity region 720 779 N/A INTRINSIC
low complexity region 878 886 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a hyperpolarization-activated cation channel that contributes to the native pacemaker currents in heart and neurons. The encoded protein can homodimerize or heterodimerize with other pore-forming subunits to form a potassium channel. This channel may act as a receptor for sour tastes. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for disruptions in this allele display learning deficiencies but are otherwise normal. Mice homozygous for another targeted knock-out exhibit deficit in hyperpolarization-activated currents and cold allodynia following partial nerve ligation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik A G 1: 105,721,287 D717G probably damaging Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Capg T C 6: 72,561,099 Y323H probably damaging Het
Cdh23 T C 10: 60,303,493 T3314A possibly damaging Het
Cilp A T 9: 65,278,278 T552S probably damaging Het
Cox16 T C 12: 81,474,519 probably null Het
Ctu2 G A 8: 122,478,239 V88I probably benign Het
Elfn1 A T 5: 139,972,314 K358* probably null Het
Enpp6 T C 8: 47,069,015 F328S probably damaging Het
Galnt12 T C 4: 47,104,231 L163P probably damaging Het
Gcfc2 G A 6: 81,941,391 R354H probably damaging Het
Ikbke C T 1: 131,275,778 probably null Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Jmjd6 T C 11: 116,842,708 R48G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lilra6 T C 7: 3,908,804 H285R possibly damaging Het
Lrp2 G A 2: 69,480,094 R2712C possibly damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Memo1 T C 17: 74,255,298 probably null Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Sema3c A G 5: 17,678,347 T318A probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Sox5 T C 6: 143,835,329 K570E probably damaging Het
Ssbp1 T G 6: 40,477,917 probably null Het
Sult5a1 A G 8: 123,149,230 S116P probably damaging Het
Tktl2 T A 8: 66,513,156 D455E probably damaging Het
Tm9sf1 T C 14: 55,641,323 Y204C probably damaging Het
Tmem161a A G 8: 70,177,426 probably benign Het
Ttn T A 2: 76,792,867 K13663* probably null Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Other mutations in Hcn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Hcn1 APN 13 117975993 missense probably damaging 1.00
IGL00340:Hcn1 APN 13 117602977 missense unknown
IGL01161:Hcn1 APN 13 117656922 missense unknown
IGL01723:Hcn1 APN 13 117976055 missense probably damaging 0.98
IGL02324:Hcn1 APN 13 117902886 missense unknown
IGL02491:Hcn1 APN 13 117810040 missense unknown
Thump UTSW 13 117873905 nonsense probably null
FR4976:Hcn1 UTSW 13 117975808 small insertion probably benign
PIT4504001:Hcn1 UTSW 13 117975875 missense possibly damaging 0.90
R0420:Hcn1 UTSW 13 117975375 missense unknown
R1546:Hcn1 UTSW 13 117975766 small insertion probably benign
R1558:Hcn1 UTSW 13 117975576 missense unknown
R1659:Hcn1 UTSW 13 117976074 missense probably damaging 0.99
R1667:Hcn1 UTSW 13 117603073 missense unknown
R1766:Hcn1 UTSW 13 117656734 missense probably benign 0.39
R1842:Hcn1 UTSW 13 117976008 missense probably damaging 0.99
R2051:Hcn1 UTSW 13 117976083 missense probably damaging 0.99
R3605:Hcn1 UTSW 13 117975252 missense unknown
R4259:Hcn1 UTSW 13 117975348 missense unknown
R4637:Hcn1 UTSW 13 117975713 missense unknown
R4679:Hcn1 UTSW 13 117657015 missense probably benign 0.39
R4777:Hcn1 UTSW 13 117975733 small deletion probably benign
R4839:Hcn1 UTSW 13 117925710 missense unknown
R4883:Hcn1 UTSW 13 117902895 critical splice donor site probably null
R5015:Hcn1 UTSW 13 117603020 missense unknown
R5060:Hcn1 UTSW 13 117873905 nonsense probably null
R5748:Hcn1 UTSW 13 117976055 missense probably damaging 0.99
R5823:Hcn1 UTSW 13 117602852 missense unknown
R6900:Hcn1 UTSW 13 117656827 missense probably benign 0.39
R7045:Hcn1 UTSW 13 117975462 missense unknown
R7049:Hcn1 UTSW 13 117975462 missense unknown
R7163:Hcn1 UTSW 13 117925547 missense unknown
R7534:Hcn1 UTSW 13 117975425 missense unknown
R7722:Hcn1 UTSW 13 117902778 missense unknown
R8083:Hcn1 UTSW 13 117975760 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- CCTATACCACAGCAGTCTGC -3'
(R):5'- CAAAGTGGAGACCTCATGGG -3'

Sequencing Primer
(F):5'- AGTCTGCAGTCCTCCTATACAGAG -3'
(R):5'- AAAGGGGCCTGACTTCTTTG -3'
Posted On2015-06-20