Incidental Mutation 'R4285:Man2a2'
ID 322028
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock # R4285 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 80368619 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 141 (D141G)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000205436] [ENSMUST00000206212] [ENSMUST00000206301]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: D141G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: D141G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205436
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205535
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206066
Predicted Effect probably benign
Transcript: ENSMUST00000206212
Predicted Effect probably damaging
Transcript: ENSMUST00000206301
AA Change: D141G

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206917
Meta Mutation Damage Score 0.7062 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8296:Man2a2 UTSW 7 80368908 missense probably damaging 0.99
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80361120 missense probably benign
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCTGCCATCTGAAAGC -3'
(R):5'- TGGAACTGACAGCCAATGCG -3'

Sequencing Primer
(F):5'- GCCATCTGAAAGCCCGCC -3'
(R):5'- CAACGGTTCCTGGGCTGTG -3'
Posted On 2015-06-20