Incidental Mutation 'R4285:Kctd19'
ID322032
Institutional Source Beutler Lab
Gene Symbol Kctd19
Ensembl Gene ENSMUSG00000051648
Gene Namepotassium channel tetramerisation domain containing 19
Synonyms4922504H04Rik
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R4285 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105382807-105413502 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 105382949 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014927] [ENSMUST00000063071] [ENSMUST00000159286] [ENSMUST00000160191] [ENSMUST00000167294] [ENSMUST00000168196] [ENSMUST00000214056]
Predicted Effect probably benign
Transcript: ENSMUST00000014927
SMART Domains Protein: ENSMUSP00000014927
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 364 377 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 463 475 N/A INTRINSIC
low complexity region 535 547 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 653 664 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
RhoGEF 729 900 3.15e-29 SMART
PH 914 1022 1.44e-5 SMART
low complexity region 1148 1169 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000063071
SMART Domains Protein: ENSMUSP00000050687
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 92 1.3e-9 PFAM
internal_repeat_1 173 251 8.34e-9 PROSPERO
internal_repeat_1 429 509 8.34e-9 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000159286
SMART Domains Protein: ENSMUSP00000125556
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
SCOP:d1aua_2 136 275 5e-9 SMART
Blast:SEC14 137 271 9e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160191
SMART Domains Protein: ENSMUSP00000125249
Gene: ENSMUSG00000014782

DomainStartEndE-ValueType
low complexity region 295 308 N/A INTRINSIC
low complexity region 371 382 N/A INTRINSIC
low complexity region 394 406 N/A INTRINSIC
low complexity region 466 478 N/A INTRINSIC
low complexity region 490 508 N/A INTRINSIC
low complexity region 584 595 N/A INTRINSIC
low complexity region 632 649 N/A INTRINSIC
RhoGEF 660 831 3.15e-29 SMART
PH 845 953 1.44e-5 SMART
low complexity region 1079 1100 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161672
Predicted Effect probably benign
Transcript: ENSMUST00000167294
SMART Domains Protein: ENSMUSP00000130831
Gene: ENSMUSG00000051648

DomainStartEndE-ValueType
Pfam:BTB_2 15 93 3.9e-10 PFAM
internal_repeat_1 173 251 6.24e-9 PROSPERO
internal_repeat_1 406 486 6.24e-9 PROSPERO
Predicted Effect unknown
Transcript: ENSMUST00000168196
AA Change: P148L
Predicted Effect probably benign
Transcript: ENSMUST00000214056
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Kctd19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Kctd19 APN 8 105388463 critical splice donor site probably null
IGL01546:Kctd19 APN 8 105386962 missense probably benign
IGL01786:Kctd19 APN 8 105390304 missense probably benign 0.03
IGL01964:Kctd19 APN 8 105388525 missense probably damaging 0.99
IGL02275:Kctd19 APN 8 105396374 missense probably damaging 0.99
IGL02479:Kctd19 APN 8 105384768 missense probably damaging 1.00
IGL03124:Kctd19 APN 8 105387070 missense possibly damaging 0.48
R0003:Kctd19 UTSW 8 105395361 missense probably damaging 0.99
R1183:Kctd19 UTSW 8 105382966 missense probably benign
R1388:Kctd19 UTSW 8 105392051 missense probably null 0.93
R1491:Kctd19 UTSW 8 105387062 missense possibly damaging 0.60
R1517:Kctd19 UTSW 8 105395376 missense probably damaging 1.00
R1540:Kctd19 UTSW 8 105387879 missense probably damaging 0.96
R1582:Kctd19 UTSW 8 105395460 missense probably damaging 1.00
R1964:Kctd19 UTSW 8 105388470 missense probably damaging 0.98
R1996:Kctd19 UTSW 8 105395300 missense probably null 1.00
R2129:Kctd19 UTSW 8 105385172 missense probably damaging 0.98
R2281:Kctd19 UTSW 8 105387266 missense probably benign 0.00
R3767:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R3768:Kctd19 UTSW 8 105396480 missense probably benign 0.04
R4621:Kctd19 UTSW 8 105396471 missense probably damaging 1.00
R4701:Kctd19 UTSW 8 105390429 missense possibly damaging 0.76
R4969:Kctd19 UTSW 8 105396327 splice site probably null
R5070:Kctd19 UTSW 8 105391999 missense probably damaging 1.00
R5401:Kctd19 UTSW 8 105382985 missense probably benign 0.00
R5582:Kctd19 UTSW 8 105408443 missense probably damaging 1.00
R5783:Kctd19 UTSW 8 105386980 missense probably benign
R6056:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6057:Kctd19 UTSW 8 105396450 missense probably damaging 0.99
R6269:Kctd19 UTSW 8 105395360 missense possibly damaging 0.96
R6273:Kctd19 UTSW 8 105385485 missense probably benign
R6631:Kctd19 UTSW 8 105385328 critical splice donor site probably null
R7298:Kctd19 UTSW 8 105382984 missense probably benign 0.01
R7474:Kctd19 UTSW 8 105392032 missense probably benign 0.25
R7540:Kctd19 UTSW 8 105386935 missense probably benign 0.00
R8059:Kctd19 UTSW 8 105396351 missense probably benign 0.02
Z1088:Kctd19 UTSW 8 105385335 missense probably benign 0.02
Z1176:Kctd19 UTSW 8 105385136 missense probably damaging 1.00
Z1177:Kctd19 UTSW 8 105388517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCAGTGACACTCTGTTTTC -3'
(R):5'- TCCCTGCTCAGATAAGGGAG -3'

Sequencing Primer
(F):5'- GTTTTCTCAGAGAAGAAATCTAGGC -3'
(R):5'- CCTCACACGGAGCTAGAGTG -3'
Posted On2015-06-20