Incidental Mutation 'R4285:Vat1l'
ID322033
Institutional Source Beutler Lab
Gene Symbol Vat1l
Ensembl Gene ENSMUSG00000046844
Gene Namevesicle amine transport protein 1 like
Synonyms
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R4285 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location114205612-114374071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114205783 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 23 (E23G)
Ref Sequence ENSEMBL: ENSMUSP00000116680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049509] [ENSMUST00000150963]
Predicted Effect probably benign
Transcript: ENSMUST00000049509
AA Change: E23G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: E23G

DomainStartEndE-ValueType
Pfam:ADH_N 66 142 3.9e-14 PFAM
Pfam:ADH_zinc_N 190 302 1.4e-11 PFAM
Pfam:ADH_zinc_N_2 221 376 1.1e-14 PFAM
low complexity region 389 408 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142591
Predicted Effect probably damaging
Transcript: ENSMUST00000150963
AA Change: E23G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116680
Gene: ENSMUSG00000046844
AA Change: E23G

DomainStartEndE-ValueType
Pfam:ADH_N 83 127 2.2e-6 PFAM
Meta Mutation Damage Score 0.0865 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Vat1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Vat1l APN 8 114369889 missense possibly damaging 0.89
IGL03379:Vat1l APN 8 114282266 missense probably damaging 0.98
R0504:Vat1l UTSW 8 114236579 splice site probably benign
R1222:Vat1l UTSW 8 114282361 splice site probably benign
R1418:Vat1l UTSW 8 114282361 splice site probably benign
R1859:Vat1l UTSW 8 114271301 missense probably damaging 1.00
R3777:Vat1l UTSW 8 114236800 critical splice donor site probably null
R3778:Vat1l UTSW 8 114236800 critical splice donor site probably null
R4154:Vat1l UTSW 8 114205803 missense possibly damaging 0.94
R4158:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4160:Vat1l UTSW 8 114371729 missense probably benign 0.32
R4507:Vat1l UTSW 8 114205816 missense probably benign 0.02
R5316:Vat1l UTSW 8 114284348 missense probably damaging 1.00
R6306:Vat1l UTSW 8 114371651 missense probably damaging 1.00
R7031:Vat1l UTSW 8 114271432 missense possibly damaging 0.60
R7162:Vat1l UTSW 8 114236778 missense probably damaging 0.99
R7378:Vat1l UTSW 8 114289392 missense possibly damaging 0.93
R7472:Vat1l UTSW 8 114236799 critical splice donor site probably null
R7662:Vat1l UTSW 8 114282344 missense probably damaging 1.00
RF032:Vat1l UTSW 8 114289329 missense probably damaging 1.00
RF035:Vat1l UTSW 8 114289329 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236622 missense probably damaging 1.00
X0062:Vat1l UTSW 8 114236623 missense probably damaging 1.00
Z1188:Vat1l UTSW 8 114205723 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TCCTCTAAGGATTACGGCGG -3'
(R):5'- GGATACTGGACCAGGCTTTGAC -3'

Sequencing Primer
(F):5'- TCACAGAGGTTGCAGCCATTG -3'
(R):5'- TGACGCGGATCTTGAGCTC -3'
Posted On2015-06-20