Mutagenetix > Incidental Mutation

Incidental Mutation 'R4285:Vat1l'

322033

Institutional Source

Beutler Lab

Gene Symbol

Vat1l

Ensembl Gene

ENSMUSG00000046844

Gene Name

vesicle amine transport protein 1 like

Synonyms

MMRRC Submission

041080-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4285 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

114205612-114374071 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 114205783 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 23 (E23G)

Ref Sequence

ENSEMBL: ENSMUSP00000116680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049509] [ENSMUST00000150963]

AlphaFold

Q80TB8

Predicted Effect

probably benign
Transcript: ENSMUST00000049509
AA Change: E23G

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000053431
Gene: ENSMUSG00000046844
AA Change: E23G

Domain	Start	End	E-Value	Type
Pfam:ADH_N	66	142	3.9e-14	PFAM
Pfam:ADH_zinc_N	190	302	1.4e-11	PFAM
Pfam:ADH_zinc_N_2	221	376	1.1e-14	PFAM
low complexity region	389	408	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142591

Predicted Effect

probably damaging
Transcript: ENSMUST00000150963
AA Change: E23G

PolyPhen 2 Score 0.971 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000116680
Gene: ENSMUSG00000046844
AA Change: E23G

Domain	Start	End	E-Value	Type
Pfam:ADH_N	83	127	2.2e-6	PFAM

Meta Mutation Damage Score

0.0865

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

98% (42/43)

Allele List at MGI

Other mutations in this stock

Total: 40 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700123L14Rik	T	C	6: 96,165,752	T104A	probably benign	Het
Agl	G	A	3: 116,752,178	S1323L	possibly damaging	Het
Ahnak	T	A	19: 9,016,839	C5162*	probably null	Het
Carmil3	GGACGA	GGA	14: 55,499,476		probably benign	Het
Cfap73	T	C	5: 120,632,589	K39E	possibly damaging	Het
Coq6	C	T	12: 84,370,404		probably benign	Het
Dlc1	C	T	8: 36,574,128	E1316K	possibly damaging	Het
Dscam	A	G	16: 96,709,109		probably null	Het
Eya2	T	A	2: 165,724,780	N250K	probably benign	Het
Fat4	A	G	3: 38,889,171	I738V	probably benign	Het
Gria2	T	G	3: 80,707,662		probably benign	Het
Hnrnph3	A	T	10: 63,016,468	D238E	probably damaging	Het
Il1rn	T	C	2: 24,349,545	L151P	probably damaging	Het
Kctd19	G	A	8: 105,382,949		probably benign	Het
Kdm1a	T	C	4: 136,582,036		probably null	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lamc1	C	A	1: 153,234,552	G1126W	probably damaging	Het
Magi3	C	A	3: 104,015,868	G1178*	probably null	Het
Man2a2	T	C	7: 80,368,619	D141G	probably damaging	Het
Map2k1	C	A	9: 64,212,643	V127L	probably damaging	Het
Memo1	T	C	17: 74,255,298		probably null	Het
Mxd3	A	G	13: 55,329,354	S31P	probably benign	Het
Myo5b	G	A	18: 74,714,849	E1053K	probably benign	Het
Olfr164	A	C	16: 19,285,964	F260V	probably damaging	Het
Olfr586	G	T	7: 103,122,660	Y37*	probably null	Het
Pex5l	A	G	3: 33,007,187	I171T	probably damaging	Het
Plag1	A	G	4: 3,905,654	V12A	probably benign	Het
Podn	C	A	4: 108,021,696	V180L	possibly damaging	Het
Prox2	T	A	12: 85,094,924	R168S	probably benign	Het
Prss29	A	G	17: 25,322,257	Y225C	probably damaging	Het
Rassf2	G	A	2: 132,005,394	T97I	probably benign	Het
Samm50	T	C	15: 84,197,012	V47A	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc20a2	G	A	8: 22,561,349	R466Q	probably benign	Het
Slc25a51	C	T	4: 45,399,768	V141M	probably benign	Het
St6galnac3	A	C	3: 153,206,723	V161G	probably benign	Het
Unc5c	T	C	3: 141,714,674	I52T	probably damaging	Het
Vmn2r91	A	G	17: 18,135,768	T566A	probably benign	Het
Wls	A	T	3: 159,934,266	H511L	probably benign	Het
Zfp644	G	A	5: 106,635,118	T1130I	probably damaging	Het

Other mutations in Vat1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Vat1l	APN	8	114369889	missense	possibly damaging	0.89
IGL03379:Vat1l	APN	8	114282266	missense	probably damaging	0.98
R0504:Vat1l	UTSW	8	114236579	splice site	probably benign
R1222:Vat1l	UTSW	8	114282361	splice site	probably benign
R1418:Vat1l	UTSW	8	114282361	splice site	probably benign
R1859:Vat1l	UTSW	8	114271301	missense	probably damaging	1.00
R3777:Vat1l	UTSW	8	114236800	critical splice donor site	probably null
R3778:Vat1l	UTSW	8	114236800	critical splice donor site	probably null
R4154:Vat1l	UTSW	8	114205803	missense	possibly damaging	0.94
R4158:Vat1l	UTSW	8	114371729	missense	probably benign	0.32
R4160:Vat1l	UTSW	8	114371729	missense	probably benign	0.32
R4507:Vat1l	UTSW	8	114205816	missense	probably benign	0.02
R5316:Vat1l	UTSW	8	114284348	missense	probably damaging	1.00
R6306:Vat1l	UTSW	8	114371651	missense	probably damaging	1.00
R7031:Vat1l	UTSW	8	114271432	missense	possibly damaging	0.60
R7162:Vat1l	UTSW	8	114236778	missense	probably damaging	0.99
R7378:Vat1l	UTSW	8	114289392	missense	possibly damaging	0.93
R7472:Vat1l	UTSW	8	114236799	critical splice donor site	probably null
R7662:Vat1l	UTSW	8	114282344	missense	probably damaging	1.00
R9269:Vat1l	UTSW	8	114289432	missense	probably damaging	1.00
RF032:Vat1l	UTSW	8	114289329	missense	probably damaging	1.00
RF035:Vat1l	UTSW	8	114289329	missense	probably damaging	1.00
X0062:Vat1l	UTSW	8	114236622	missense	probably damaging	1.00
X0062:Vat1l	UTSW	8	114236623	missense	probably damaging	1.00
Z1188:Vat1l	UTSW	8	114205723	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TCCTCTAAGGATTACGGCGG -3'
(R):5'- GGATACTGGACCAGGCTTTGAC -3'

Sequencing Primer
(F):5'- TCACAGAGGTTGCAGCCATTG -3'
(R):5'- TGACGCGGATCTTGAGCTC -3'

Posted On

2015-06-20