Incidental Mutation 'R4285:Samm50'
ID 322040
Institutional Source Beutler Lab
Gene Symbol Samm50
Ensembl Gene ENSMUSG00000022437
Gene Name SAMM50 sorting and assembly machinery component
Synonyms 1110030L07Rik
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock # R4285 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 84192241-84217267 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84197012 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 47 (V47A)
Ref Sequence ENSEMBL: ENSMUSP00000023071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023071]
AlphaFold Q8BGH2
Predicted Effect probably damaging
Transcript: ENSMUST00000023071
AA Change: V47A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023071
Gene: ENSMUSG00000022437
AA Change: V47A

DomainStartEndE-ValueType
low complexity region 24 35 N/A INTRINSIC
Pfam:Bac_surface_Ag 151 468 1.8e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229608
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230498
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230668
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230830
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231124
Meta Mutation Damage Score 0.7157 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the Sorting and Assembly Machinery (SAM) of the mitochondrial outer membrane. The Sam complex functions in the assembly of beta-barrel proteins into the outer mitochondrial membrane.[provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr164 A C 16: 19,285,964 F260V probably damaging Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Samm50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Samm50 APN 15 84200375 missense possibly damaging 0.82
IGL01061:Samm50 APN 15 84202254 missense probably benign 0.00
IGL01549:Samm50 APN 15 84202781 missense probably benign
IGL01586:Samm50 APN 15 84195838 missense probably benign 0.03
IGL02494:Samm50 APN 15 84195814 missense probably benign
IGL02607:Samm50 APN 15 84207838 missense probably benign 0.09
IGL03244:Samm50 APN 15 84214140 missense probably benign 0.09
IGL03340:Samm50 APN 15 84198663 critical splice donor site probably null
R0591:Samm50 UTSW 15 84211168 missense probably benign
R0634:Samm50 UTSW 15 84214171 synonymous silent
R1780:Samm50 UTSW 15 84211127 missense probably damaging 0.99
R2192:Samm50 UTSW 15 84200424 critical splice donor site probably null
R2205:Samm50 UTSW 15 84202314 missense probably benign 0.01
R3800:Samm50 UTSW 15 84192374 missense probably damaging 0.99
R4333:Samm50 UTSW 15 84202830 missense probably benign 0.02
R4780:Samm50 UTSW 15 84210610 missense possibly damaging 0.88
R5223:Samm50 UTSW 15 84200630 missense probably benign 0.07
R5639:Samm50 UTSW 15 84214128 missense probably benign 0.22
R6258:Samm50 UTSW 15 84200311 missense probably damaging 1.00
R6258:Samm50 UTSW 15 84200312 missense probably damaging 0.98
R6437:Samm50 UTSW 15 84204097 critical splice donor site probably null
R6452:Samm50 UTSW 15 84204097 critical splice donor site probably benign
R6715:Samm50 UTSW 15 84211058 missense probably benign
R6957:Samm50 UTSW 15 84198649 missense probably damaging 1.00
R7409:Samm50 UTSW 15 84197030 missense probably benign 0.32
R7459:Samm50 UTSW 15 84195856 critical splice donor site probably null
R7706:Samm50 UTSW 15 84200880 splice site probably null
R7910:Samm50 UTSW 15 84214145 missense possibly damaging 0.49
R8421:Samm50 UTSW 15 84210585 missense probably benign 0.04
R8443:Samm50 UTSW 15 84210501 missense possibly damaging 0.82
R9339:Samm50 UTSW 15 84211075 missense probably benign 0.00
X0067:Samm50 UTSW 15 84202833 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTGAAATAGGAGTACAGGAGCTG -3'
(R):5'- CCGACAGTTTATGTAAGCTCTGG -3'

Sequencing Primer
(F):5'- TTTCCAGAGGACTTGGATACCAGC -3'
(R):5'- ATGTAAGCTCTGGGAGGCGC -3'
Posted On 2015-06-20