Incidental Mutation 'R4285:Olfr164'
ID322041
Institutional Source Beutler Lab
Gene Symbol Olfr164
Ensembl Gene ENSMUSG00000050742
Gene Nameolfactory receptor 164
SynonymsGA_x54KRFPKG5P-15738260-15737319, MOR279-2
MMRRC Submission 041080-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4285 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location19284104-19314064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 19285964 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 260 (F260V)
Ref Sequence ENSEMBL: ENSMUSP00000149971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056727] [ENSMUST00000216157]
Predicted Effect probably damaging
Transcript: ENSMUST00000056727
AA Change: F260V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056970
Gene: ENSMUSG00000050742
AA Change: F260V

DomainStartEndE-ValueType
Pfam:7tm_4 32 311 2.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 38 308 8.2e-8 PFAM
Pfam:7tm_1 44 293 5.9e-24 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216157
AA Change: F260V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.3450 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik T C 6: 96,165,752 T104A probably benign Het
Agl G A 3: 116,752,178 S1323L possibly damaging Het
Ahnak T A 19: 9,016,839 C5162* probably null Het
Carmil3 GGACGA GGA 14: 55,499,476 probably benign Het
Cfap73 T C 5: 120,632,589 K39E possibly damaging Het
Coq6 C T 12: 84,370,404 probably benign Het
Dlc1 C T 8: 36,574,128 E1316K possibly damaging Het
Dscam A G 16: 96,709,109 probably null Het
Eya2 T A 2: 165,724,780 N250K probably benign Het
Fat4 A G 3: 38,889,171 I738V probably benign Het
Gria2 T G 3: 80,707,662 probably benign Het
Hnrnph3 A T 10: 63,016,468 D238E probably damaging Het
Il1rn T C 2: 24,349,545 L151P probably damaging Het
Kctd19 G A 8: 105,382,949 probably benign Het
Kdm1a T C 4: 136,582,036 probably null Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lamc1 C A 1: 153,234,552 G1126W probably damaging Het
Magi3 C A 3: 104,015,868 G1178* probably null Het
Man2a2 T C 7: 80,368,619 D141G probably damaging Het
Map2k1 C A 9: 64,212,643 V127L probably damaging Het
Memo1 T C 17: 74,255,298 probably null Het
Mxd3 A G 13: 55,329,354 S31P probably benign Het
Myo5b G A 18: 74,714,849 E1053K probably benign Het
Olfr586 G T 7: 103,122,660 Y37* probably null Het
Pex5l A G 3: 33,007,187 I171T probably damaging Het
Plag1 A G 4: 3,905,654 V12A probably benign Het
Podn C A 4: 108,021,696 V180L possibly damaging Het
Prox2 T A 12: 85,094,924 R168S probably benign Het
Prss29 A G 17: 25,322,257 Y225C probably damaging Het
Rassf2 G A 2: 132,005,394 T97I probably benign Het
Samm50 T C 15: 84,197,012 V47A probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc20a2 G A 8: 22,561,349 R466Q probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
St6galnac3 A C 3: 153,206,723 V161G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Vat1l A G 8: 114,205,783 E23G probably damaging Het
Vmn2r91 A G 17: 18,135,768 T566A probably benign Het
Wls A T 3: 159,934,266 H511L probably benign Het
Zfp644 G A 5: 106,635,118 T1130I probably damaging Het
Other mutations in Olfr164
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01529:Olfr164 APN 16 19286700 missense probably benign 0.01
IGL01569:Olfr164 APN 16 19286660 missense probably benign 0.28
IGL01619:Olfr164 APN 16 19286159 missense probably damaging 1.00
IGL02101:Olfr164 APN 16 19286613 missense probably benign
IGL02201:Olfr164 APN 16 19286462 missense probably benign 0.03
IGL02730:Olfr164 APN 16 19286682 missense probably benign 0.00
IGL03228:Olfr164 APN 16 19286390 missense probably damaging 1.00
R1566:Olfr164 UTSW 16 19286327 missense possibly damaging 0.76
R1817:Olfr164 UTSW 16 19285877 missense probably damaging 1.00
R1870:Olfr164 UTSW 16 19286607 missense probably damaging 1.00
R1918:Olfr164 UTSW 16 19286302 missense probably benign 0.03
R2202:Olfr164 UTSW 16 19286297 missense probably benign 0.03
R2265:Olfr164 UTSW 16 19286555 missense probably damaging 1.00
R3792:Olfr164 UTSW 16 19285946 missense possibly damaging 0.54
R4961:Olfr164 UTSW 16 19285976 missense probably damaging 1.00
R5022:Olfr164 UTSW 16 19286059 missense probably damaging 1.00
R5432:Olfr164 UTSW 16 19286089 missense probably benign 0.06
R5827:Olfr164 UTSW 16 19286432 missense probably benign 0.24
R6154:Olfr164 UTSW 16 19286431 missense probably damaging 0.99
R6188:Olfr164 UTSW 16 19286557 missense probably damaging 1.00
R6367:Olfr164 UTSW 16 19286072 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAACTCATGCTGCTGC -3'
(R):5'- TGTGGTGCCAGAGAAATACC -3'

Sequencing Primer
(F):5'- AACTCATGCTGCTGCCTTATCAATC -3'
(R):5'- GCCTTACTCACACTTTCATGTAG -3'
Posted On2015-06-20