Incidental Mutation 'R4287:Il1rn'
List |< first << previous [record 8 of 38] next >> last >|
ID322048
Institutional Source Beutler Lab
Gene Symbol Il1rn
Ensembl Gene ENSMUSG00000026981
Gene Nameinterleukin 1 receptor antagonist
SynonymsF630041P17Rik, IL-1ra
MMRRC Submission 041652-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R4287 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location24336853-24351494 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24349545 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 151 (L151P)
Ref Sequence ENSEMBL: ENSMUSP00000110126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114482] [ENSMUST00000114485] [ENSMUST00000114487] [ENSMUST00000142093]
Predicted Effect probably damaging
Transcript: ENSMUST00000114482
AA Change: L151P

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000110126
Gene: ENSMUSG00000026981
AA Change: L151P

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IL1 34 175 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114485
AA Change: L135P

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110129
Gene: ENSMUSG00000026981
AA Change: L135P

DomainStartEndE-ValueType
IL1 18 159 2.88e-70 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114487
AA Change: L132P

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110131
Gene: ENSMUSG00000026981
AA Change: L132P

DomainStartEndE-ValueType
IL1 15 156 2.88e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142093
SMART Domains Protein: ENSMUSP00000141269
Gene: ENSMUSG00000026981

DomainStartEndE-ValueType
PDB:1IRP|A 8 50 1e-21 PDB
Blast:IL1 15 50 9e-20 BLAST
SCOP:d1ilr1_ 16 50 3e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143423
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (40/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]
PHENOTYPE: Nullizygous mutations of this gene may result in decreased body weight, increased inflammatory response to turpentine and LPS, decreased susceptibility to bacterial infection, psoriasis, aortitis, rheumatoid arthritis, and abnormal dendritic and CD4-positive T cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc5 A G 5: 122,800,601 V362A probably benign Het
Ash1l T A 3: 89,066,415 C2594S probably damaging Het
Ccdc82 C A 9: 13,253,418 Q303K probably benign Het
Cog1 A G 11: 113,654,027 Y345C probably damaging Het
Fpgt T C 3: 155,091,360 probably benign Het
Glrb A T 3: 80,845,232 V408D possibly damaging Het
Gm7135 A G 1: 97,400,398 noncoding transcript Het
Itgav G T 2: 83,724,840 E36* probably null Het
Kidins220 G A 12: 25,056,846 E1433K possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Klra3 A G 6: 130,334,302 C39R probably benign Het
Lce1i A G 3: 92,777,435 S145P unknown Het
Memo1 T C 17: 74,255,298 probably null Het
Mpp3 G A 11: 102,023,463 A102V probably damaging Het
Mug2 T A 6: 122,063,673 D727E probably benign Het
Ndufb8 T C 19: 44,552,691 I107V probably benign Het
Olfr186 A T 16: 59,027,613 M98K probably benign Het
Pnn C T 12: 59,072,170 T513I possibly damaging Het
Ric8a A G 7: 140,861,422 Y210C probably damaging Het
Ripor2 G A 13: 24,725,009 V1037M probably damaging Het
Rreb1 A T 13: 37,931,931 T1089S probably benign Het
Rrs1 C T 1: 9,546,215 S231L probably damaging Het
Rrs1 C T 1: 9,546,223 R234C possibly damaging Het
Sec23ip A G 7: 128,777,333 D838G probably benign Het
Setbp1 T C 18: 78,859,061 I464V probably benign Het
Slc25a51 C T 4: 45,399,768 V141M probably benign Het
Slc41a3 A T 6: 90,640,922 H310L probably benign Het
Smurf1 A G 5: 144,891,458 S363P probably benign Het
Tln1 C T 4: 43,543,509 R1269Q probably benign Het
Tmed3 A G 9: 89,704,898 S10P probably benign Het
Tomm70a T G 16: 57,140,622 Y313D probably damaging Het
Umodl1 A G 17: 30,988,065 E810G probably benign Het
Unc5c T C 3: 141,714,674 I52T probably damaging Het
Unc5d T A 8: 28,719,796 Y432F probably benign Het
Vmn2r97 A T 17: 18,948,075 probably benign Het
Zfp629 T C 7: 127,611,938 Y233C probably damaging Het
Zfp986 T C 4: 145,892,518 probably null Het
Other mutations in Il1rn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01516:Il1rn APN 2 24349539 missense probably damaging 1.00
IGL02606:Il1rn APN 2 24345450 intron probably benign
R1251:Il1rn UTSW 2 24345570 missense probably damaging 1.00
R1943:Il1rn UTSW 2 24348599 missense possibly damaging 0.94
R4284:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R4285:Il1rn UTSW 2 24349545 missense probably damaging 0.96
R5317:Il1rn UTSW 2 24349542 missense probably benign 0.30
R5322:Il1rn UTSW 2 24348629 critical splice donor site probably null
R6662:Il1rn UTSW 2 24336875 start gained probably null
R7427:Il1rn UTSW 2 24349542 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCCACAAGCATGAGTTTGTTG -3'
(R):5'- CACCCTGCAAAAGTTGTTCC -3'

Sequencing Primer
(F):5'- CAATGGACAGGAACACCTTTTAG -3'
(R):5'- GCAAAAGTTGTTCCTCAGGC -3'
Posted On2015-06-20